ID: 1003556021

View in Genome Browser
Species Human (GRCh38)
Location 6:7141100-7141122
Sequence GCGGCCGTGGAGCCCTGACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556021_1003556026 -9 Left 1003556021 6:7141100-7141122 CCGCGTCAGGGCTCCACGGCCGC No data
Right 1003556026 6:7141114-7141136 CACGGCCGCAGGGGCCCCCTCGG No data
1003556021_1003556037 16 Left 1003556021 6:7141100-7141122 CCGCGTCAGGGCTCCACGGCCGC No data
Right 1003556037 6:7141139-7141161 CGCCCCCAGGGCTCCCGCGGTGG 0: 1
1: 0
2: 1
3: 33
4: 187
1003556021_1003556029 3 Left 1003556021 6:7141100-7141122 CCGCGTCAGGGCTCCACGGCCGC No data
Right 1003556029 6:7141126-7141148 GGCCCCCTCGGGCCGCCCCCAGG 0: 1
1: 0
2: 2
3: 28
4: 320
1003556021_1003556027 -8 Left 1003556021 6:7141100-7141122 CCGCGTCAGGGCTCCACGGCCGC No data
Right 1003556027 6:7141115-7141137 ACGGCCGCAGGGGCCCCCTCGGG No data
1003556021_1003556030 4 Left 1003556021 6:7141100-7141122 CCGCGTCAGGGCTCCACGGCCGC No data
Right 1003556030 6:7141127-7141149 GCCCCCTCGGGCCGCCCCCAGGG No data
1003556021_1003556043 24 Left 1003556021 6:7141100-7141122 CCGCGTCAGGGCTCCACGGCCGC No data
Right 1003556043 6:7141147-7141169 GGGCTCCCGCGGTGGGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1003556021_1003556038 17 Left 1003556021 6:7141100-7141122 CCGCGTCAGGGCTCCACGGCCGC No data
Right 1003556038 6:7141140-7141162 GCCCCCAGGGCTCCCGCGGTGGG No data
1003556021_1003556035 13 Left 1003556021 6:7141100-7141122 CCGCGTCAGGGCTCCACGGCCGC No data
Right 1003556035 6:7141136-7141158 GGCCGCCCCCAGGGCTCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556021 Original CRISPR GCGGCCGTGGAGCCCTGACG CGG (reversed) Intronic