ID: 1003556025

View in Genome Browser
Species Human (GRCh38)
Location 6:7141113-7141135
Sequence CGAGGGGGCCCCTGCGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 274}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556025_1003556043 11 Left 1003556025 6:7141113-7141135 CCACGGCCGCAGGGGCCCCCTCG 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1003556043 6:7141147-7141169 GGGCTCCCGCGGTGGGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1003556025_1003556048 27 Left 1003556025 6:7141113-7141135 CCACGGCCGCAGGGGCCCCCTCG 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556025_1003556030 -9 Left 1003556025 6:7141113-7141135 CCACGGCCGCAGGGGCCCCCTCG 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1003556030 6:7141127-7141149 GCCCCCTCGGGCCGCCCCCAGGG No data
1003556025_1003556038 4 Left 1003556025 6:7141113-7141135 CCACGGCCGCAGGGGCCCCCTCG 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1003556038 6:7141140-7141162 GCCCCCAGGGCTCCCGCGGTGGG No data
1003556025_1003556047 19 Left 1003556025 6:7141113-7141135 CCACGGCCGCAGGGGCCCCCTCG 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1003556047 6:7141155-7141177 GCGGTGGGTGTCCGGTGAGCGGG No data
1003556025_1003556037 3 Left 1003556025 6:7141113-7141135 CCACGGCCGCAGGGGCCCCCTCG 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1003556037 6:7141139-7141161 CGCCCCCAGGGCTCCCGCGGTGG 0: 1
1: 0
2: 1
3: 33
4: 187
1003556025_1003556029 -10 Left 1003556025 6:7141113-7141135 CCACGGCCGCAGGGGCCCCCTCG 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1003556029 6:7141126-7141148 GGCCCCCTCGGGCCGCCCCCAGG 0: 1
1: 0
2: 2
3: 28
4: 320
1003556025_1003556046 18 Left 1003556025 6:7141113-7141135 CCACGGCCGCAGGGGCCCCCTCG 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1003556046 6:7141154-7141176 CGCGGTGGGTGTCCGGTGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 65
1003556025_1003556035 0 Left 1003556025 6:7141113-7141135 CCACGGCCGCAGGGGCCCCCTCG 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1003556035 6:7141136-7141158 GGCCGCCCCCAGGGCTCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556025 Original CRISPR CGAGGGGGCCCCTGCGGCCG TGG (reversed) Intronic