ID: 1003556028

View in Genome Browser
Species Human (GRCh38)
Location 6:7141119-7141141
Sequence GCGGCCCGAGGGGGCCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 275}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556028_1003556043 5 Left 1003556028 6:7141119-7141141 CCGCAGGGGCCCCCTCGGGCCGC 0: 1
1: 0
2: 0
3: 35
4: 275
Right 1003556043 6:7141147-7141169 GGGCTCCCGCGGTGGGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1003556028_1003556035 -6 Left 1003556028 6:7141119-7141141 CCGCAGGGGCCCCCTCGGGCCGC 0: 1
1: 0
2: 0
3: 35
4: 275
Right 1003556035 6:7141136-7141158 GGCCGCCCCCAGGGCTCCCGCGG No data
1003556028_1003556037 -3 Left 1003556028 6:7141119-7141141 CCGCAGGGGCCCCCTCGGGCCGC 0: 1
1: 0
2: 0
3: 35
4: 275
Right 1003556037 6:7141139-7141161 CGCCCCCAGGGCTCCCGCGGTGG 0: 1
1: 0
2: 1
3: 33
4: 187
1003556028_1003556046 12 Left 1003556028 6:7141119-7141141 CCGCAGGGGCCCCCTCGGGCCGC 0: 1
1: 0
2: 0
3: 35
4: 275
Right 1003556046 6:7141154-7141176 CGCGGTGGGTGTCCGGTGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 65
1003556028_1003556047 13 Left 1003556028 6:7141119-7141141 CCGCAGGGGCCCCCTCGGGCCGC 0: 1
1: 0
2: 0
3: 35
4: 275
Right 1003556047 6:7141155-7141177 GCGGTGGGTGTCCGGTGAGCGGG No data
1003556028_1003556048 21 Left 1003556028 6:7141119-7141141 CCGCAGGGGCCCCCTCGGGCCGC 0: 1
1: 0
2: 0
3: 35
4: 275
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556028_1003556038 -2 Left 1003556028 6:7141119-7141141 CCGCAGGGGCCCCCTCGGGCCGC 0: 1
1: 0
2: 0
3: 35
4: 275
Right 1003556038 6:7141140-7141162 GCCCCCAGGGCTCCCGCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556028 Original CRISPR GCGGCCCGAGGGGGCCCCTG CGG (reversed) Intronic