ID: 1003556031

View in Genome Browser
Species Human (GRCh38)
Location 6:7141128-7141150
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556031_1003556048 12 Left 1003556031 6:7141128-7141150 CCCCCTCGGGCCGCCCCCAGGGC No data
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556031_1003556052 28 Left 1003556031 6:7141128-7141150 CCCCCTCGGGCCGCCCCCAGGGC No data
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556031_1003556043 -4 Left 1003556031 6:7141128-7141150 CCCCCTCGGGCCGCCCCCAGGGC No data
Right 1003556043 6:7141147-7141169 GGGCTCCCGCGGTGGGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1003556031_1003556046 3 Left 1003556031 6:7141128-7141150 CCCCCTCGGGCCGCCCCCAGGGC No data
Right 1003556046 6:7141154-7141176 CGCGGTGGGTGTCCGGTGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 65
1003556031_1003556050 24 Left 1003556031 6:7141128-7141150 CCCCCTCGGGCCGCCCCCAGGGC No data
Right 1003556050 6:7141175-7141197 GGGTAGCGAGGCCATCAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1003556031_1003556047 4 Left 1003556031 6:7141128-7141150 CCCCCTCGGGCCGCCCCCAGGGC No data
Right 1003556047 6:7141155-7141177 GCGGTGGGTGTCCGGTGAGCGGG No data
1003556031_1003556051 25 Left 1003556031 6:7141128-7141150 CCCCCTCGGGCCGCCCCCAGGGC No data
Right 1003556051 6:7141176-7141198 GGTAGCGAGGCCATCAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556031 Original CRISPR GCCCTGGGGGCGGCCCGAGG GGG (reversed) Intronic