ID: 1003556033

View in Genome Browser
Species Human (GRCh38)
Location 6:7141130-7141152
Sequence GAGCCCTGGGGGCGGCCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 269}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556033_1003556046 1 Left 1003556033 6:7141130-7141152 CCCTCGGGCCGCCCCCAGGGCTC 0: 1
1: 0
2: 2
3: 15
4: 269
Right 1003556046 6:7141154-7141176 CGCGGTGGGTGTCCGGTGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 65
1003556033_1003556053 29 Left 1003556033 6:7141130-7141152 CCCTCGGGCCGCCCCCAGGGCTC 0: 1
1: 0
2: 2
3: 15
4: 269
Right 1003556053 6:7141182-7141204 GAGGCCATCAGTCAGGGCGGCGG 0: 1
1: 0
2: 2
3: 19
4: 237
1003556033_1003556047 2 Left 1003556033 6:7141130-7141152 CCCTCGGGCCGCCCCCAGGGCTC 0: 1
1: 0
2: 2
3: 15
4: 269
Right 1003556047 6:7141155-7141177 GCGGTGGGTGTCCGGTGAGCGGG No data
1003556033_1003556052 26 Left 1003556033 6:7141130-7141152 CCCTCGGGCCGCCCCCAGGGCTC 0: 1
1: 0
2: 2
3: 15
4: 269
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556033_1003556048 10 Left 1003556033 6:7141130-7141152 CCCTCGGGCCGCCCCCAGGGCTC 0: 1
1: 0
2: 2
3: 15
4: 269
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556033_1003556050 22 Left 1003556033 6:7141130-7141152 CCCTCGGGCCGCCCCCAGGGCTC 0: 1
1: 0
2: 2
3: 15
4: 269
Right 1003556050 6:7141175-7141197 GGGTAGCGAGGCCATCAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1003556033_1003556051 23 Left 1003556033 6:7141130-7141152 CCCTCGGGCCGCCCCCAGGGCTC 0: 1
1: 0
2: 2
3: 15
4: 269
Right 1003556051 6:7141176-7141198 GGTAGCGAGGCCATCAGTCAGGG No data
1003556033_1003556043 -6 Left 1003556033 6:7141130-7141152 CCCTCGGGCCGCCCCCAGGGCTC 0: 1
1: 0
2: 2
3: 15
4: 269
Right 1003556043 6:7141147-7141169 GGGCTCCCGCGGTGGGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1003556033_1003556054 30 Left 1003556033 6:7141130-7141152 CCCTCGGGCCGCCCCCAGGGCTC 0: 1
1: 0
2: 2
3: 15
4: 269
Right 1003556054 6:7141183-7141205 AGGCCATCAGTCAGGGCGGCGGG 0: 1
1: 0
2: 1
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556033 Original CRISPR GAGCCCTGGGGGCGGCCCGA GGG (reversed) Intronic