ID: 1003556035

View in Genome Browser
Species Human (GRCh38)
Location 6:7141136-7141158
Sequence GGCCGCCCCCAGGGCTCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556015_1003556035 29 Left 1003556015 6:7141084-7141106 CCGGGCAGCCGACTGCCCGCGTC No data
Right 1003556035 6:7141136-7141158 GGCCGCCCCCAGGGCTCCCGCGG No data
1003556028_1003556035 -6 Left 1003556028 6:7141119-7141141 CCGCAGGGGCCCCCTCGGGCCGC 0: 1
1: 0
2: 0
3: 35
4: 275
Right 1003556035 6:7141136-7141158 GGCCGCCCCCAGGGCTCCCGCGG No data
1003556020_1003556035 14 Left 1003556020 6:7141099-7141121 CCCGCGTCAGGGCTCCACGGCCG 0: 1
1: 0
2: 0
3: 2
4: 134
Right 1003556035 6:7141136-7141158 GGCCGCCCCCAGGGCTCCCGCGG No data
1003556025_1003556035 0 Left 1003556025 6:7141113-7141135 CCACGGCCGCAGGGGCCCCCTCG 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1003556035 6:7141136-7141158 GGCCGCCCCCAGGGCTCCCGCGG No data
1003556021_1003556035 13 Left 1003556021 6:7141100-7141122 CCGCGTCAGGGCTCCACGGCCGC No data
Right 1003556035 6:7141136-7141158 GGCCGCCCCCAGGGCTCCCGCGG No data
1003556018_1003556035 21 Left 1003556018 6:7141092-7141114 CCGACTGCCCGCGTCAGGGCTCC 0: 1
1: 0
2: 1
3: 15
4: 124
Right 1003556035 6:7141136-7141158 GGCCGCCCCCAGGGCTCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556035 Original CRISPR GGCCGCCCCCAGGGCTCCCG CGG Intronic