ID: 1003556036

View in Genome Browser
Species Human (GRCh38)
Location 6:7141138-7141160
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 274}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556036_1003556046 -7 Left 1003556036 6:7141138-7141160 CCGCCCCCAGGGCTCCCGCGGTG 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1003556046 6:7141154-7141176 CGCGGTGGGTGTCCGGTGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 65
1003556036_1003556051 15 Left 1003556036 6:7141138-7141160 CCGCCCCCAGGGCTCCCGCGGTG 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1003556051 6:7141176-7141198 GGTAGCGAGGCCATCAGTCAGGG No data
1003556036_1003556053 21 Left 1003556036 6:7141138-7141160 CCGCCCCCAGGGCTCCCGCGGTG 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1003556053 6:7141182-7141204 GAGGCCATCAGTCAGGGCGGCGG 0: 1
1: 0
2: 2
3: 19
4: 237
1003556036_1003556054 22 Left 1003556036 6:7141138-7141160 CCGCCCCCAGGGCTCCCGCGGTG 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1003556054 6:7141183-7141205 AGGCCATCAGTCAGGGCGGCGGG 0: 1
1: 0
2: 1
3: 17
4: 141
1003556036_1003556052 18 Left 1003556036 6:7141138-7141160 CCGCCCCCAGGGCTCCCGCGGTG 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556036_1003556047 -6 Left 1003556036 6:7141138-7141160 CCGCCCCCAGGGCTCCCGCGGTG 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1003556047 6:7141155-7141177 GCGGTGGGTGTCCGGTGAGCGGG No data
1003556036_1003556050 14 Left 1003556036 6:7141138-7141160 CCGCCCCCAGGGCTCCCGCGGTG 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1003556050 6:7141175-7141197 GGGTAGCGAGGCCATCAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1003556036_1003556048 2 Left 1003556036 6:7141138-7141160 CCGCCCCCAGGGCTCCCGCGGTG 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556036 Original CRISPR CACCGCGGGAGCCCTGGGGG CGG (reversed) Intronic