ID: 1003556037

View in Genome Browser
Species Human (GRCh38)
Location 6:7141139-7141161
Sequence CGCCCCCAGGGCTCCCGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556028_1003556037 -3 Left 1003556028 6:7141119-7141141 CCGCAGGGGCCCCCTCGGGCCGC 0: 1
1: 0
2: 0
3: 35
4: 275
Right 1003556037 6:7141139-7141161 CGCCCCCAGGGCTCCCGCGGTGG 0: 1
1: 0
2: 1
3: 33
4: 187
1003556021_1003556037 16 Left 1003556021 6:7141100-7141122 CCGCGTCAGGGCTCCACGGCCGC No data
Right 1003556037 6:7141139-7141161 CGCCCCCAGGGCTCCCGCGGTGG 0: 1
1: 0
2: 1
3: 33
4: 187
1003556020_1003556037 17 Left 1003556020 6:7141099-7141121 CCCGCGTCAGGGCTCCACGGCCG 0: 1
1: 0
2: 0
3: 2
4: 134
Right 1003556037 6:7141139-7141161 CGCCCCCAGGGCTCCCGCGGTGG 0: 1
1: 0
2: 1
3: 33
4: 187
1003556018_1003556037 24 Left 1003556018 6:7141092-7141114 CCGACTGCCCGCGTCAGGGCTCC 0: 1
1: 0
2: 1
3: 15
4: 124
Right 1003556037 6:7141139-7141161 CGCCCCCAGGGCTCCCGCGGTGG 0: 1
1: 0
2: 1
3: 33
4: 187
1003556025_1003556037 3 Left 1003556025 6:7141113-7141135 CCACGGCCGCAGGGGCCCCCTCG 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1003556037 6:7141139-7141161 CGCCCCCAGGGCTCCCGCGGTGG 0: 1
1: 0
2: 1
3: 33
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556037 Original CRISPR CGCCCCCAGGGCTCCCGCGG TGG Intronic