ID: 1003556040

View in Genome Browser
Species Human (GRCh38)
Location 6:7141142-7141164
Sequence CACCCACCGCGGGAGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 165}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556040_1003556052 14 Left 1003556040 6:7141142-7141164 CCCCAGGGCTCCCGCGGTGGGTG 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556040_1003556056 28 Left 1003556040 6:7141142-7141164 CCCCAGGGCTCCCGCGGTGGGTG 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1003556056 6:7141193-7141215 TCAGGGCGGCGGGCGCCGATTGG 0: 1
1: 0
2: 1
3: 4
4: 81
1003556040_1003556050 10 Left 1003556040 6:7141142-7141164 CCCCAGGGCTCCCGCGGTGGGTG 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1003556050 6:7141175-7141197 GGGTAGCGAGGCCATCAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1003556040_1003556053 17 Left 1003556040 6:7141142-7141164 CCCCAGGGCTCCCGCGGTGGGTG 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1003556053 6:7141182-7141204 GAGGCCATCAGTCAGGGCGGCGG 0: 1
1: 0
2: 2
3: 19
4: 237
1003556040_1003556047 -10 Left 1003556040 6:7141142-7141164 CCCCAGGGCTCCCGCGGTGGGTG 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1003556047 6:7141155-7141177 GCGGTGGGTGTCCGGTGAGCGGG No data
1003556040_1003556048 -2 Left 1003556040 6:7141142-7141164 CCCCAGGGCTCCCGCGGTGGGTG 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556040_1003556051 11 Left 1003556040 6:7141142-7141164 CCCCAGGGCTCCCGCGGTGGGTG 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1003556051 6:7141176-7141198 GGTAGCGAGGCCATCAGTCAGGG No data
1003556040_1003556054 18 Left 1003556040 6:7141142-7141164 CCCCAGGGCTCCCGCGGTGGGTG 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1003556054 6:7141183-7141205 AGGCCATCAGTCAGGGCGGCGGG 0: 1
1: 0
2: 1
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556040 Original CRISPR CACCCACCGCGGGAGCCCTG GGG (reversed) Intronic