ID: 1003556041

View in Genome Browser
Species Human (GRCh38)
Location 6:7141143-7141165
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 156}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556041_1003556052 13 Left 1003556041 6:7141143-7141165 CCCAGGGCTCCCGCGGTGGGTGT 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556041_1003556048 -3 Left 1003556041 6:7141143-7141165 CCCAGGGCTCCCGCGGTGGGTGT 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556041_1003556056 27 Left 1003556041 6:7141143-7141165 CCCAGGGCTCCCGCGGTGGGTGT 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1003556056 6:7141193-7141215 TCAGGGCGGCGGGCGCCGATTGG 0: 1
1: 0
2: 1
3: 4
4: 81
1003556041_1003556053 16 Left 1003556041 6:7141143-7141165 CCCAGGGCTCCCGCGGTGGGTGT 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1003556053 6:7141182-7141204 GAGGCCATCAGTCAGGGCGGCGG 0: 1
1: 0
2: 2
3: 19
4: 237
1003556041_1003556054 17 Left 1003556041 6:7141143-7141165 CCCAGGGCTCCCGCGGTGGGTGT 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1003556054 6:7141183-7141205 AGGCCATCAGTCAGGGCGGCGGG 0: 1
1: 0
2: 1
3: 17
4: 141
1003556041_1003556051 10 Left 1003556041 6:7141143-7141165 CCCAGGGCTCCCGCGGTGGGTGT 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1003556051 6:7141176-7141198 GGTAGCGAGGCCATCAGTCAGGG No data
1003556041_1003556050 9 Left 1003556041 6:7141143-7141165 CCCAGGGCTCCCGCGGTGGGTGT 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1003556050 6:7141175-7141197 GGGTAGCGAGGCCATCAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556041 Original CRISPR ACACCCACCGCGGGAGCCCT GGG (reversed) Intronic