ID: 1003556043

View in Genome Browser
Species Human (GRCh38)
Location 6:7141147-7141169
Sequence GGGCTCCCGCGGTGGGTGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556034_1003556043 -7 Left 1003556034 6:7141131-7141153 CCTCGGGCCGCCCCCAGGGCTCC 0: 1
1: 1
2: 7
3: 45
4: 471
Right 1003556043 6:7141147-7141169 GGGCTCCCGCGGTGGGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1003556028_1003556043 5 Left 1003556028 6:7141119-7141141 CCGCAGGGGCCCCCTCGGGCCGC 0: 1
1: 0
2: 0
3: 35
4: 275
Right 1003556043 6:7141147-7141169 GGGCTCCCGCGGTGGGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1003556032_1003556043 -5 Left 1003556032 6:7141129-7141151 CCCCTCGGGCCGCCCCCAGGGCT 0: 1
1: 0
2: 3
3: 11
4: 272
Right 1003556043 6:7141147-7141169 GGGCTCCCGCGGTGGGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1003556025_1003556043 11 Left 1003556025 6:7141113-7141135 CCACGGCCGCAGGGGCCCCCTCG 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1003556043 6:7141147-7141169 GGGCTCCCGCGGTGGGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1003556033_1003556043 -6 Left 1003556033 6:7141130-7141152 CCCTCGGGCCGCCCCCAGGGCTC 0: 1
1: 0
2: 2
3: 15
4: 269
Right 1003556043 6:7141147-7141169 GGGCTCCCGCGGTGGGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1003556021_1003556043 24 Left 1003556021 6:7141100-7141122 CCGCGTCAGGGCTCCACGGCCGC No data
Right 1003556043 6:7141147-7141169 GGGCTCCCGCGGTGGGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1003556020_1003556043 25 Left 1003556020 6:7141099-7141121 CCCGCGTCAGGGCTCCACGGCCG 0: 1
1: 0
2: 0
3: 2
4: 134
Right 1003556043 6:7141147-7141169 GGGCTCCCGCGGTGGGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1003556031_1003556043 -4 Left 1003556031 6:7141128-7141150 CCCCCTCGGGCCGCCCCCAGGGC No data
Right 1003556043 6:7141147-7141169 GGGCTCCCGCGGTGGGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556043 Original CRISPR GGGCTCCCGCGGTGGGTGTC CGG Intronic