ID: 1003556045

View in Genome Browser
Species Human (GRCh38)
Location 6:7141153-7141175
Sequence CGCTCACCGGACACCCACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556045_1003556051 0 Left 1003556045 6:7141153-7141175 CCGCGGTGGGTGTCCGGTGAGCG No data
Right 1003556051 6:7141176-7141198 GGTAGCGAGGCCATCAGTCAGGG No data
1003556045_1003556060 29 Left 1003556045 6:7141153-7141175 CCGCGGTGGGTGTCCGGTGAGCG No data
Right 1003556060 6:7141205-7141227 GCGCCGATTGGCTGGCGGGCTGG 0: 1
1: 1
2: 1
3: 7
4: 110
1003556045_1003556052 3 Left 1003556045 6:7141153-7141175 CCGCGGTGGGTGTCCGGTGAGCG No data
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556045_1003556050 -1 Left 1003556045 6:7141153-7141175 CCGCGGTGGGTGTCCGGTGAGCG No data
Right 1003556050 6:7141175-7141197 GGGTAGCGAGGCCATCAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1003556045_1003556054 7 Left 1003556045 6:7141153-7141175 CCGCGGTGGGTGTCCGGTGAGCG No data
Right 1003556054 6:7141183-7141205 AGGCCATCAGTCAGGGCGGCGGG 0: 1
1: 0
2: 1
3: 17
4: 141
1003556045_1003556056 17 Left 1003556045 6:7141153-7141175 CCGCGGTGGGTGTCCGGTGAGCG No data
Right 1003556056 6:7141193-7141215 TCAGGGCGGCGGGCGCCGATTGG 0: 1
1: 0
2: 1
3: 4
4: 81
1003556045_1003556058 24 Left 1003556045 6:7141153-7141175 CCGCGGTGGGTGTCCGGTGAGCG No data
Right 1003556058 6:7141200-7141222 GGCGGGCGCCGATTGGCTGGCGG 0: 1
1: 1
2: 1
3: 19
4: 118
1003556045_1003556053 6 Left 1003556045 6:7141153-7141175 CCGCGGTGGGTGTCCGGTGAGCG No data
Right 1003556053 6:7141182-7141204 GAGGCCATCAGTCAGGGCGGCGG 0: 1
1: 0
2: 2
3: 19
4: 237
1003556045_1003556059 25 Left 1003556045 6:7141153-7141175 CCGCGGTGGGTGTCCGGTGAGCG No data
Right 1003556059 6:7141201-7141223 GCGGGCGCCGATTGGCTGGCGGG 0: 1
1: 1
2: 5
3: 9
4: 86
1003556045_1003556057 21 Left 1003556045 6:7141153-7141175 CCGCGGTGGGTGTCCGGTGAGCG No data
Right 1003556057 6:7141197-7141219 GGCGGCGGGCGCCGATTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556045 Original CRISPR CGCTCACCGGACACCCACCG CGG (reversed) Intronic