ID: 1003556048

View in Genome Browser
Species Human (GRCh38)
Location 6:7141163-7141185
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 33}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556025_1003556048 27 Left 1003556025 6:7141113-7141135 CCACGGCCGCAGGGGCCCCCTCG 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556034_1003556048 9 Left 1003556034 6:7141131-7141153 CCTCGGGCCGCCCCCAGGGCTCC 0: 1
1: 1
2: 7
3: 45
4: 471
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556028_1003556048 21 Left 1003556028 6:7141119-7141141 CCGCAGGGGCCCCCTCGGGCCGC 0: 1
1: 0
2: 0
3: 35
4: 275
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556036_1003556048 2 Left 1003556036 6:7141138-7141160 CCGCCCCCAGGGCTCCCGCGGTG 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556040_1003556048 -2 Left 1003556040 6:7141142-7141164 CCCCAGGGCTCCCGCGGTGGGTG 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556042_1003556048 -4 Left 1003556042 6:7141144-7141166 CCAGGGCTCCCGCGGTGGGTGTC No data
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556031_1003556048 12 Left 1003556031 6:7141128-7141150 CCCCCTCGGGCCGCCCCCAGGGC No data
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556041_1003556048 -3 Left 1003556041 6:7141143-7141165 CCCAGGGCTCCCGCGGTGGGTGT 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556033_1003556048 10 Left 1003556033 6:7141130-7141152 CCCTCGGGCCGCCCCCAGGGCTC 0: 1
1: 0
2: 2
3: 15
4: 269
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556032_1003556048 11 Left 1003556032 6:7141129-7141151 CCCCTCGGGCCGCCCCCAGGGCT 0: 1
1: 0
2: 3
3: 11
4: 272
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33
1003556039_1003556048 -1 Left 1003556039 6:7141141-7141163 CCCCCAGGGCTCCCGCGGTGGGT 0: 1
1: 0
2: 1
3: 12
4: 111
Right 1003556048 6:7141163-7141185 TGTCCGGTGAGCGGGTAGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type