ID: 1003556049

View in Genome Browser
Species Human (GRCh38)
Location 6:7141166-7141188
Sequence TGGCCTCGCTACCCGCTCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556049_1003556062 19 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556062 6:7141208-7141230 CCGATTGGCTGGCGGGCTGGCGG No data
1003556049_1003556066 26 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556066 6:7141215-7141237 GCTGGCGGGCTGGCGGGGGCCGG 0: 1
1: 0
2: 11
3: 132
4: 1034
1003556049_1003556065 22 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556065 6:7141211-7141233 ATTGGCTGGCGGGCTGGCGGGGG 0: 1
1: 0
2: 0
3: 37
4: 320
1003556049_1003556052 -10 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556049_1003556057 8 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556057 6:7141197-7141219 GGCGGCGGGCGCCGATTGGCTGG No data
1003556049_1003556064 21 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556064 6:7141210-7141232 GATTGGCTGGCGGGCTGGCGGGG No data
1003556049_1003556063 20 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556063 6:7141209-7141231 CGATTGGCTGGCGGGCTGGCGGG 0: 1
1: 0
2: 2
3: 185
4: 707
1003556049_1003556056 4 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556056 6:7141193-7141215 TCAGGGCGGCGGGCGCCGATTGG 0: 1
1: 0
2: 1
3: 4
4: 81
1003556049_1003556053 -7 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556053 6:7141182-7141204 GAGGCCATCAGTCAGGGCGGCGG 0: 1
1: 0
2: 2
3: 19
4: 237
1003556049_1003556060 16 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556060 6:7141205-7141227 GCGCCGATTGGCTGGCGGGCTGG 0: 1
1: 1
2: 1
3: 7
4: 110
1003556049_1003556058 11 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556058 6:7141200-7141222 GGCGGGCGCCGATTGGCTGGCGG 0: 1
1: 1
2: 1
3: 19
4: 118
1003556049_1003556068 30 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556068 6:7141219-7141241 GCGGGCTGGCGGGGGCCGGGCGG 0: 1
1: 0
2: 13
3: 154
4: 1260
1003556049_1003556054 -6 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556054 6:7141183-7141205 AGGCCATCAGTCAGGGCGGCGGG 0: 1
1: 0
2: 1
3: 17
4: 141
1003556049_1003556059 12 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556059 6:7141201-7141223 GCGGGCGCCGATTGGCTGGCGGG 0: 1
1: 1
2: 5
3: 9
4: 86
1003556049_1003556067 27 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556067 6:7141216-7141238 CTGGCGGGCTGGCGGGGGCCGGG 0: 1
1: 0
2: 7
3: 82
4: 742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556049 Original CRISPR TGGCCTCGCTACCCGCTCAC CGG (reversed) Intronic