ID: 1003556052

View in Genome Browser
Species Human (GRCh38)
Location 6:7141179-7141201
Sequence AGCGAGGCCATCAGTCAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 117}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556044_1003556052 4 Left 1003556044 6:7141152-7141174 CCCGCGGTGGGTGTCCGGTGAGC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556049_1003556052 -10 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556032_1003556052 27 Left 1003556032 6:7141129-7141151 CCCCTCGGGCCGCCCCCAGGGCT 0: 1
1: 0
2: 3
3: 11
4: 272
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556045_1003556052 3 Left 1003556045 6:7141153-7141175 CCGCGGTGGGTGTCCGGTGAGCG No data
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556031_1003556052 28 Left 1003556031 6:7141128-7141150 CCCCCTCGGGCCGCCCCCAGGGC No data
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556034_1003556052 25 Left 1003556034 6:7141131-7141153 CCTCGGGCCGCCCCCAGGGCTCC 0: 1
1: 1
2: 7
3: 45
4: 471
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556040_1003556052 14 Left 1003556040 6:7141142-7141164 CCCCAGGGCTCCCGCGGTGGGTG 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556033_1003556052 26 Left 1003556033 6:7141130-7141152 CCCTCGGGCCGCCCCCAGGGCTC 0: 1
1: 0
2: 2
3: 15
4: 269
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556039_1003556052 15 Left 1003556039 6:7141141-7141163 CCCCCAGGGCTCCCGCGGTGGGT 0: 1
1: 0
2: 1
3: 12
4: 111
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556041_1003556052 13 Left 1003556041 6:7141143-7141165 CCCAGGGCTCCCGCGGTGGGTGT 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556042_1003556052 12 Left 1003556042 6:7141144-7141166 CCAGGGCTCCCGCGGTGGGTGTC No data
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117
1003556036_1003556052 18 Left 1003556036 6:7141138-7141160 CCGCCCCCAGGGCTCCCGCGGTG 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1003556052 6:7141179-7141201 AGCGAGGCCATCAGTCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556052 Original CRISPR AGCGAGGCCATCAGTCAGGG CGG Intronic