ID: 1003556056

View in Genome Browser
Species Human (GRCh38)
Location 6:7141193-7141215
Sequence TCAGGGCGGCGGGCGCCGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 81}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556040_1003556056 28 Left 1003556040 6:7141142-7141164 CCCCAGGGCTCCCGCGGTGGGTG 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1003556056 6:7141193-7141215 TCAGGGCGGCGGGCGCCGATTGG 0: 1
1: 0
2: 1
3: 4
4: 81
1003556039_1003556056 29 Left 1003556039 6:7141141-7141163 CCCCCAGGGCTCCCGCGGTGGGT 0: 1
1: 0
2: 1
3: 12
4: 111
Right 1003556056 6:7141193-7141215 TCAGGGCGGCGGGCGCCGATTGG 0: 1
1: 0
2: 1
3: 4
4: 81
1003556042_1003556056 26 Left 1003556042 6:7141144-7141166 CCAGGGCTCCCGCGGTGGGTGTC No data
Right 1003556056 6:7141193-7141215 TCAGGGCGGCGGGCGCCGATTGG 0: 1
1: 0
2: 1
3: 4
4: 81
1003556049_1003556056 4 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556056 6:7141193-7141215 TCAGGGCGGCGGGCGCCGATTGG 0: 1
1: 0
2: 1
3: 4
4: 81
1003556041_1003556056 27 Left 1003556041 6:7141143-7141165 CCCAGGGCTCCCGCGGTGGGTGT 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1003556056 6:7141193-7141215 TCAGGGCGGCGGGCGCCGATTGG 0: 1
1: 0
2: 1
3: 4
4: 81
1003556044_1003556056 18 Left 1003556044 6:7141152-7141174 CCCGCGGTGGGTGTCCGGTGAGC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1003556056 6:7141193-7141215 TCAGGGCGGCGGGCGCCGATTGG 0: 1
1: 0
2: 1
3: 4
4: 81
1003556045_1003556056 17 Left 1003556045 6:7141153-7141175 CCGCGGTGGGTGTCCGGTGAGCG No data
Right 1003556056 6:7141193-7141215 TCAGGGCGGCGGGCGCCGATTGG 0: 1
1: 0
2: 1
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556056 Original CRISPR TCAGGGCGGCGGGCGCCGAT TGG Intronic