ID: 1003556059

View in Genome Browser
Species Human (GRCh38)
Location 6:7141201-7141223
Sequence GCGGGCGCCGATTGGCTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 1, 2: 5, 3: 9, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003556044_1003556059 26 Left 1003556044 6:7141152-7141174 CCCGCGGTGGGTGTCCGGTGAGC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1003556059 6:7141201-7141223 GCGGGCGCCGATTGGCTGGCGGG 0: 1
1: 1
2: 5
3: 9
4: 86
1003556055_1003556059 -8 Left 1003556055 6:7141186-7141208 CCATCAGTCAGGGCGGCGGGCGC No data
Right 1003556059 6:7141201-7141223 GCGGGCGCCGATTGGCTGGCGGG 0: 1
1: 1
2: 5
3: 9
4: 86
1003556045_1003556059 25 Left 1003556045 6:7141153-7141175 CCGCGGTGGGTGTCCGGTGAGCG No data
Right 1003556059 6:7141201-7141223 GCGGGCGCCGATTGGCTGGCGGG 0: 1
1: 1
2: 5
3: 9
4: 86
1003556049_1003556059 12 Left 1003556049 6:7141166-7141188 CCGGTGAGCGGGTAGCGAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1003556059 6:7141201-7141223 GCGGGCGCCGATTGGCTGGCGGG 0: 1
1: 1
2: 5
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003556059 Original CRISPR GCGGGCGCCGATTGGCTGGC GGG Intronic