ID: 1003556069 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:7141220-7141242 |
Sequence | CGGGCTGGCGGGGGCCGGGC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1601 | |||
Summary | {0: 1, 1: 0, 2: 13, 3: 177, 4: 1410} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1003556055_1003556069 | 11 | Left | 1003556055 | 6:7141186-7141208 | CCATCAGTCAGGGCGGCGGGCGC | No data | ||
Right | 1003556069 | 6:7141220-7141242 | CGGGCTGGCGGGGGCCGGGCGGG | 0: 1 1: 0 2: 13 3: 177 4: 1410 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1003556069 | Original CRISPR | CGGGCTGGCGGGGGCCGGGC GGG | Intronic | ||