ID: 1003561341

View in Genome Browser
Species Human (GRCh38)
Location 6:7183362-7183384
Sequence TTGTCCAATGGGCTGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003561341_1003561348 18 Left 1003561341 6:7183362-7183384 CCATCCATCAGCCCATTGGACAA 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1003561348 6:7183403-7183425 ATCCAGCTAGCTACTGTACCAGG 0: 1
1: 0
2: 0
3: 4
4: 53
1003561341_1003561350 25 Left 1003561341 6:7183362-7183384 CCATCCATCAGCCCATTGGACAA 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1003561350 6:7183410-7183432 TAGCTACTGTACCAGGTGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003561341 Original CRISPR TTGTCCAATGGGCTGATGGA TGG (reversed) Intronic
902472450 1:16658266-16658288 TTGTCTCATGGGCTGAGCGAGGG + Intergenic
902486354 1:16749180-16749202 TTGTCTCATGGGCTGAGCGAGGG - Intronic
904267434 1:29325834-29325856 TTGTCCCATGGGCGGGTGGTGGG + Intronic
908426581 1:64013687-64013709 TGGTCAAAGGGGTTGATGGAAGG - Intronic
910530009 1:88225193-88225215 TTGTGCAATGGGCAGATGGATGG + Intergenic
913509671 1:119550256-119550278 TAGACACATGGGCTGATGGAGGG + Intergenic
913517152 1:119614379-119614401 TAGACACATGGGCTGATGGATGG + Intergenic
915232245 1:154454313-154454335 TTGTCAAATGGCCTGTTGGTTGG + Intronic
915405148 1:155654436-155654458 TTCTCCATTGGGCTGTTTGAGGG + Intergenic
915723415 1:158000765-158000787 TTGTTAAATGGGCTCAAGGAGGG - Intronic
918527119 1:185477301-185477323 GTGACCAAGGGACTGATGGAAGG - Intergenic
919127625 1:193415334-193415356 TGGTCCAATGGGATGACAGATGG + Intergenic
920227964 1:204451509-204451531 TTGTTGAATGGGCTGCAGGAAGG - Intronic
922495590 1:226054963-226054985 TTGTCCCAAGGCCTCATGGAGGG - Intergenic
922849183 1:228717908-228717930 TGGTCCAATGTGTTAATGGAGGG - Intergenic
1065281808 10:24146740-24146762 TTGTCTGCTGTGCTGATGGAAGG + Intronic
1066134837 10:32434707-32434729 TTGTTCCATGGGCTGAAGAATGG + Intergenic
1066408639 10:35144144-35144166 TTGTCCAGTGTGGTGATGGGAGG + Intronic
1068046572 10:51893690-51893712 TTGGCCAAGGGGCTGCTGTAGGG - Intronic
1068330323 10:55556960-55556982 TTGACCAATTGGCAGAGGGAAGG + Intronic
1068855232 10:61791052-61791074 TTGTCCTATGAACTGAAGGATGG - Intergenic
1069422588 10:68260548-68260570 AGGTCCAATGGGCTGCTGGTAGG + Intergenic
1074090988 10:110255417-110255439 TGGTCCAATGGGCTGCAGAATGG - Intronic
1085866045 11:80294130-80294152 TTGTTGAATGGGTAGATGGAAGG + Intergenic
1086873936 11:92072833-92072855 TTTTCCAATGGGCTTATCAAAGG + Intergenic
1087599780 11:100298815-100298837 TTGTCCTATGGTCTGGTGGTCGG - Intronic
1088830679 11:113533603-113533625 TTCTCCAAAGGGCAGAGGGATGG - Intergenic
1090006052 11:123003179-123003201 TTGTCCAATGAGCAGATCCATGG + Intergenic
1094002363 12:25708470-25708492 TTGTTGGATGGGCTGAAGGAAGG - Intergenic
1094220034 12:27982892-27982914 ATGTACAATGTGCTGATGGTTGG - Intergenic
1094604491 12:31938769-31938791 TTCTCCATTGGGCTGTTTGAGGG + Intergenic
1095970360 12:47897553-47897575 TTGTCCCATGGGTGGATGGGTGG + Intronic
1096113631 12:49042600-49042622 GAGTCCATTGGGCTGCTGGAGGG + Exonic
1101470772 12:104995076-104995098 TTGTCCGATGGGCTGAGGCTTGG + Exonic
1101506988 12:105356013-105356035 TTGGCCAATGGGCTCATCCAGGG + Intronic
1101542399 12:105676925-105676947 TTGCCCACTGGGCTGCTGGCAGG - Intergenic
1104529710 12:129557761-129557783 TTGAGCATGGGGCTGATGGATGG + Intronic
1106510146 13:30406202-30406224 TTTTCCACTGTGCTGGTGGAGGG + Intergenic
1107104198 13:36626009-36626031 CTGTCTAATGGGCTGATGTGAGG + Intergenic
1109782627 13:67131954-67131976 CAGTCAAATGTGCTGATGGATGG - Intronic
1110814826 13:79849677-79849699 TTGTACACTGGGGTTATGGAAGG + Intergenic
1112662495 13:101527259-101527281 GTTGCCTATGGGCTGATGGAAGG - Intronic
1116497155 14:45574927-45574949 TTGACCAAAGGGATGAGGGAAGG - Intergenic
1118602137 14:67478286-67478308 TTGGCCAGTGGGATGATGGTGGG - Intronic
1121362508 14:93274478-93274500 TTTTCCAATGGAGGGATGGAAGG + Intronic
1121929579 14:97960262-97960284 TTGGACCATGGCCTGATGGAAGG - Intronic
1122815775 14:104312538-104312560 TTGGTCAATTGGCTGAGGGATGG + Intergenic
1122972219 14:105156986-105157008 TTGGCCAATGGGTTGGAGGAGGG - Intronic
1129119944 15:73390071-73390093 TTGTCCCATCGGCAGATGGGAGG - Intergenic
1131779763 15:95843617-95843639 TTGTCCTATGGGCTGACAAAGGG + Intergenic
1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG + Intronic
1133890781 16:9876776-9876798 TGGTCTGATGGGCTGATGAATGG + Intronic
1136091023 16:27920068-27920090 ATGTACAATGGGTTCATGGAAGG - Intronic
1138543931 16:57705389-57705411 TTGGCGAATGGGAGGATGGATGG - Intronic
1139209160 16:65059456-65059478 TTTTCCAAAGCGCCGATGGACGG + Intronic
1139491088 16:67286427-67286449 TTGTCCTGTGGGCGGATGGGAGG - Exonic
1139666506 16:68460627-68460649 CAGTGGAATGGGCTGATGGAAGG - Intergenic
1140721944 16:77780066-77780088 TTGGACAATTGGGTGATGGATGG + Intergenic
1140778971 16:78276278-78276300 TTGTCAAATGGGGTCATAGAGGG + Intronic
1145304605 17:21666428-21666450 TTGGACTATGGGCTGCTGGATGG + Intergenic
1148900049 17:50868034-50868056 TTGTGGAATGGGCTGAGGGTGGG + Intergenic
1151793108 17:76322490-76322512 TTGTTCAATGGGCTGCAGAATGG - Intronic
1152034034 17:77861065-77861087 TTGGTCAATGGGTGGATGGACGG + Intergenic
1153270500 18:3316471-3316493 TTGACCCATGGGCTGAAGAATGG + Intergenic
1153334751 18:3911672-3911694 TTTTCTAATGAGCTGATTGATGG + Intronic
1153828991 18:8903378-8903400 ATGTCCCATGTGCTGATGAAAGG - Intergenic
1155161055 18:23196362-23196384 TTGTGCAAAGGGCAGATGAAAGG + Intronic
1156762893 18:40614676-40614698 ATGTCTGATGGGATGATGGATGG + Intergenic
1160772468 19:839155-839177 TGGTCCCAAGGGCTGAGGGAGGG + Intergenic
1167411186 19:49344820-49344842 TTGGCCACTGGGGTCATGGAGGG - Intronic
1202704845 1_KI270713v1_random:15088-15110 TTGTCTCATGGGCTGAGCGAGGG + Intergenic
926106914 2:10158385-10158407 TTGTGCAGGGGGATGATGGAAGG - Intronic
926834924 2:17008211-17008233 TTGACCCATGGGCTGCTGAATGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933873677 2:86596445-86596467 TTGACCCATGGGCTGAAGAATGG - Intronic
935703363 2:105834078-105834100 ATGTCCCATGTGCTGATGAAAGG + Intronic
936059888 2:109287618-109287640 TTGTCCAATGGGAGGCGGGAGGG + Intronic
936704362 2:115054406-115054428 TTTTGCAATGGGCTTATGTATGG - Intronic
937546815 2:123032158-123032180 TTGGCCAATAGGCTCATGAAGGG + Intergenic
946638960 2:221762708-221762730 CTGTCCCAGGGGCTGATGAAAGG + Intergenic
947179967 2:227403150-227403172 ATGTCAAATAGGCTGTTGGAAGG + Intergenic
948903469 2:240967293-240967315 CAGTCCAATGGGCGGGTGGAGGG - Intronic
1169642941 20:7775925-7775947 TTGACTAATGGGCAAATGGATGG - Intergenic
1170146710 20:13183058-13183080 TTGTCCTATGGACTGAAGCAAGG - Intergenic
1171522116 20:25783867-25783889 TTGGACTATGGGCTGCTGGATGG + Intronic
1171529867 20:25845812-25845834 TTGGACTATGGGCTGCTGGATGG + Intronic
1171554711 20:26072016-26072038 TTGGACTATGGGCTGCTGGATGG - Intergenic
1173961005 20:47072400-47072422 TTGTGCAAAAGGCTGCTGGAAGG + Intronic
1175220390 20:57413331-57413353 TGGTTCACTGGGATGATGGAAGG - Intergenic
1176655924 21:9588859-9588881 TTGGACTATGGGCTGCTGGATGG + Intergenic
1177197285 21:17916869-17916891 TATTCCAATGGGCTAATGGAGGG + Intronic
1178096326 21:29219530-29219552 TAGTCCAATAGGTTGTTGGAGGG + Intronic
1178418806 21:32426773-32426795 TTGTCTGAAGGGGTGATGGAGGG - Intronic
1179580071 21:42337970-42337992 TTGCCCATTGGGCTGCAGGAAGG + Intergenic
951667537 3:25143820-25143842 TTGTACAATGGGCTGTTGAGAGG + Intergenic
951746772 3:25987022-25987044 CTGACCACTGAGCTGATGGACGG - Intergenic
953971079 3:47347498-47347520 TTGTCCATTGGACTCCTGGATGG + Intergenic
955109625 3:55935479-55935501 TTGTCTAATTGACAGATGGATGG - Intronic
960754722 3:120999055-120999077 TTGTCCTATGGTCTGAGTGATGG + Intronic
962636430 3:137336547-137336569 TTTTCCAACTGGCTGATGAAAGG + Intergenic
968728114 4:2257574-2257596 TTGTCCGAGGGGCAGATGGAGGG - Intronic
973606885 4:52596659-52596681 TTGTACAACGTGCTGATGGCTGG + Exonic
975523775 4:75327677-75327699 TTGTTCAATGGACTGATGAGTGG + Intergenic
986065929 5:4233833-4233855 TTTTCCTACGGGGTGATGGAGGG - Intergenic
988498973 5:31768268-31768290 CTGTCCCTTGGGCTGATGGCTGG - Intronic
990191095 5:53260929-53260951 TTGTGCAATGGGCTTTTGAATGG - Intergenic
991527709 5:67580322-67580344 AAGTACAATCGGCTGATGGAAGG + Intergenic
992710609 5:79451041-79451063 TTGGCCAGTGGGCTGATAGCCGG - Exonic
995297886 5:110541102-110541124 TTCTCCATTGGGCTGTTTGAGGG - Intronic
996519731 5:124413542-124413564 TTGTCCAATAGGCTGGAGCATGG + Intergenic
1001800867 5:174542884-174542906 TTGGCCAATGTGCTGATGACCGG - Intergenic
1003469339 6:6414595-6414617 TTTTCCAATGGGCTGAACTATGG + Intergenic
1003561341 6:7183362-7183384 TTGTCCAATGGGCTGATGGATGG - Intronic
1003770366 6:9292255-9292277 TTGTCTAATGTGCTGCTGGTGGG + Intergenic
1007319856 6:41020036-41020058 TTGCCCTATGGGCTGTTGCAAGG + Intergenic
1011653508 6:89528752-89528774 TTGATCCATGGGCTGAAGGATGG + Intronic
1014377726 6:120697118-120697140 TTGTTCAATTGGATGATGGAAGG - Intergenic
1016076233 6:139799371-139799393 GTGTCAAGTGGGCTGGTGGAAGG + Intergenic
1018089609 6:160334246-160334268 TTGGCCATTGGGAGGATGGATGG - Intergenic
1018993606 6:168693241-168693263 TTGGCCAAGGGGCTGAGGGGAGG + Intergenic
1018993741 6:168694790-168694812 TTGGCCAAGGGGCTGAGGGGAGG - Intergenic
1021264903 7:18508119-18508141 TTGTTCAATGGAATGATGGATGG + Intronic
1023715842 7:43043218-43043240 TTGACACATGGGCTGAAGGAGGG + Intergenic
1025302112 7:57826375-57826397 TTGGACTATGGGCTGCTGGATGG - Intergenic
1029802595 7:102964901-102964923 TTGTCCAGTGGTCTGTTGTATGG - Intronic
1034650215 7:152684350-152684372 TTGTACAATAGGCTGATGCCAGG - Intergenic
1041445561 8:57948144-57948166 TTGGGCAATGGGCTGATCCAAGG + Intergenic
1047822748 8:128539497-128539519 TAGTCTTATGGGCTGATTGATGG + Intergenic
1049804328 8:144532147-144532169 CTGTCCAATGGGCAGAAGGGAGG + Intronic
1050799959 9:9598262-9598284 TTGTCCAAGGGGGTGAAGAAAGG - Intronic
1052531951 9:29696702-29696724 TTTTCCAATGGCATGATGGTGGG + Intergenic
1054714004 9:68539456-68539478 TGGTCCCAGGGGCTGGTGGAAGG - Intronic
1054767394 9:69053704-69053726 TTGTCCAGCAGGCAGATGGAGGG + Intronic
1057821145 9:98332035-98332057 CTGTCAAATGAGCTGATGGATGG - Intronic
1058699321 9:107587786-107587808 TTGTCCACTGGCCTTATCGACGG + Intergenic
1059006316 9:110406889-110406911 CTGGCCAATGGGGTGACGGAAGG - Exonic
1061782984 9:133006803-133006825 TTGTCAGATGGACAGATGGATGG + Intergenic
1203633641 Un_KI270750v1:92320-92342 TTGGACTATGGGCTGCTGGATGG + Intergenic
1186876658 X:13824560-13824582 TTGTCCAGAGGGCAGCTGGATGG + Intronic
1189135303 X:38543039-38543061 TTTTCCCATGGGCCAATGGAAGG + Intronic
1189225966 X:39413592-39413614 TTGCCCAATGGGATGAAGGTGGG - Intergenic
1189268802 X:39736077-39736099 TTGTCAAATGGGCTGAAGGTGGG - Intergenic
1191731181 X:64337343-64337365 TAGTCCATTGTTCTGATGGATGG - Exonic
1197108861 X:122748328-122748350 CTGTCCAATTGGCTGGTGGCTGG + Intergenic
1199916768 X:152350848-152350870 TTGATCAATGGGCTGAAGAATGG + Intronic