ID: 1003564207

View in Genome Browser
Species Human (GRCh38)
Location 6:7208696-7208718
Sequence CTGCAGTCCTTGAGCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003564203_1003564207 5 Left 1003564203 6:7208668-7208690 CCTGGTTTTCCAGACTAAGCCAG 0: 1
1: 0
2: 0
3: 17
4: 204
Right 1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG 0: 1
1: 0
2: 3
3: 10
4: 135
1003564202_1003564207 6 Left 1003564202 6:7208667-7208689 CCCTGGTTTTCCAGACTAAGCCA 0: 1
1: 0
2: 2
3: 15
4: 153
Right 1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG 0: 1
1: 0
2: 3
3: 10
4: 135
1003564205_1003564207 -4 Left 1003564205 6:7208677-7208699 CCAGACTAAGCCAGAGGCTCTGC 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG 0: 1
1: 0
2: 3
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003564207 Original CRISPR CTGCAGTCCTTGAGCAAAAC TGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901097222 1:6691721-6691743 CAACAGTCCATGAGCCAAACAGG + Intronic
904839330 1:33361746-33361768 CAGCAGGCCTTAAGCAAAGCAGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
911883043 1:103265863-103265885 CTGCAGTCATTGAGGAAGTCAGG - Intergenic
912564440 1:110576408-110576430 TTTCAGTCCTTCAGCAAAAAGGG + Intergenic
915057396 1:153147191-153147213 CTGCAATTCTGGAGGAAAACAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
920518411 1:206603659-206603681 TTGCAGTCCTTGAGCAGTCCAGG - Intronic
920927819 1:210359219-210359241 CTTCATTCTTTGAGCAGAACTGG - Intronic
922896659 1:229106052-229106074 CTCCTGTCCTTGAGCCACACTGG - Intergenic
923344435 1:233037290-233037312 TTCCAGTCCTTCAGCAACACTGG + Intronic
923498043 1:234541896-234541918 CAGCAGGCTTTGAGCAAAGCAGG + Intergenic
924695789 1:246398246-246398268 CTTCAGTCCCTGAGCAAGAAGGG + Intronic
1063401697 10:5752388-5752410 CTGCAGGCCGCGTGCAAAACTGG + Intronic
1064485387 10:15783183-15783205 CTGGAGTCCTTGAACAGCACTGG - Intronic
1066061576 10:31728096-31728118 CTTCAGTCCCTGAGCAAAGAGGG - Intergenic
1066196229 10:33102836-33102858 CTGCAGTCCTCAGGCAAATCTGG + Intergenic
1066209610 10:33224025-33224047 CTGCACTCCTGGAGCAAAGTGGG + Intronic
1070746829 10:78938818-78938840 CTGCAGCCCTTGGCCAACACTGG + Intergenic
1073133291 10:101204719-101204741 CTGCAGGTCTTGAACAAAACAGG + Intergenic
1074904042 10:117844971-117844993 CTGCAGTTATAGAGCAAAAGGGG + Intergenic
1078186440 11:9055662-9055684 TTGCAGTCCCTGAGCAATAGCGG - Intronic
1080787215 11:35486567-35486589 CTGCTGTCCTTGAGAAAGCCTGG + Intronic
1085508443 11:77073301-77073323 CTGCAGGCCTTGGGCAGGACAGG - Intronic
1087828348 11:102791825-102791847 CCACAGTCCATGAGCAAACCTGG - Intronic
1089676696 11:120095318-120095340 CTGCTGTCCTAGAGCAAGAGTGG + Intergenic
1090978517 11:131695969-131695991 CTGGAGTGCATGAGAAAAACTGG + Intronic
1091433759 12:458097-458119 CTGCAGTTCTTTAGCAAAAAGGG - Intergenic
1091451557 12:575429-575451 CTGTAGTCCTGGAGCAGAGCAGG - Intronic
1092115189 12:5996067-5996089 CTGCAGCCCTGGAGCAAGGCAGG - Exonic
1092673199 12:10886335-10886357 CTGCAGGCCTGGTGCAAGACAGG + Intronic
1095194834 12:39301600-39301622 CTGCAGCCACTGAGCAAAACTGG + Exonic
1096518583 12:52171657-52171679 GTGCAGTCCAGGTGCAAAACCGG - Exonic
1096599482 12:52719130-52719152 ATGCAGGCCTTGGGCTAAACTGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1107072877 13:36290949-36290971 CTGCATACCTTGACCAAAAAAGG + Intronic
1109605376 13:64687710-64687732 CTTCAGACCTTGAGAAACACAGG + Intergenic
1114596258 14:23914710-23914732 CTGCAGTCCTTGTGTTAAAATGG - Intergenic
1116551079 14:46238572-46238594 CTACAATCCTTGAGAAAAAGAGG + Intergenic
1116793680 14:49366558-49366580 CTCAAGTCCTTGAGAAAAACAGG - Intergenic
1117019256 14:51552508-51552530 CTGCAGTCACTCTGCAAAACTGG + Intronic
1118913277 14:70079703-70079725 CCTCAGTCCTTGAGAAACACAGG + Intronic
1118974020 14:70661967-70661989 CAGCCTTCCTTGAGCCAAACAGG - Intronic
1119385748 14:74257359-74257381 CTGCAGTTCCCGCGCAAAACTGG - Intronic
1120699071 14:87678108-87678130 CTGGAGTCTTTGAGCAAAGGAGG + Intergenic
1121273260 14:92651758-92651780 CTGCAGTCCTCGATGAAAATAGG - Exonic
1125751415 15:42031787-42031809 CTGCAGTAATTGAGCAAGGCTGG + Intronic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1126491498 15:49241909-49241931 CTGCAGTGCCTAAGCAAAAAGGG + Intronic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1134386057 16:13773756-13773778 GTGCAGTCCTAGAGCATTACTGG + Intergenic
1134487482 16:14669977-14669999 CCCCAGTCCCTGAGCAAATCTGG - Intergenic
1139186170 16:64808612-64808634 CTTAAGTTCTTGAGCCAAACAGG - Intergenic
1140468127 16:75198295-75198317 CTGCAGTCCTGGAGGGAATCTGG + Intergenic
1142210835 16:88807741-88807763 CTGCAGTCCTTGGTCAGAAGGGG + Intronic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1144961816 17:19048800-19048822 CTGGAGTCCCTGAGCCAACCAGG + Intergenic
1144973345 17:19125722-19125744 CTGGAGTCCCTGAGCCAACCAGG - Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG + Intronic
1146956573 17:36939549-36939571 ATCCAGTCCTTGAGGAAAACCGG - Intronic
1153967162 18:10192389-10192411 TGGCAGTCCTTGAGCAAGCCTGG - Intergenic
1157037603 18:43994423-43994445 CTGTATTCCTGCAGCAAAACTGG + Intergenic
1159051820 18:63427370-63427392 CTGAAGTCCTTGATCACAGCAGG - Intergenic
1167796279 19:51711453-51711475 GTACAGTCCCTGTGCAAAACAGG + Intergenic
925196527 2:1930385-1930407 CTGCATTTATTGAGCAAAAGAGG - Intronic
929019625 2:37538691-37538713 CTGAAGTCCTTGAGAAGAAGGGG + Intergenic
930023312 2:47014463-47014485 TTCCAGTCCTTGAGAAAAAGGGG - Intronic
931563213 2:63586790-63586812 CTGCAGTCCTATAGCAGGACAGG - Intronic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
933710221 2:85319897-85319919 TTTCAGAACTTGAGCAAAACAGG - Intronic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
946532770 2:220590250-220590272 CTGCAGTCCTTGCATAAAAGTGG - Intergenic
948534587 2:238636449-238636471 CTGCAGGCCTGAAACAAAACAGG - Intergenic
1169425415 20:5493041-5493063 CTGAAGTCCTTGAGGATACCTGG - Intergenic
1170530495 20:17286725-17286747 CTGCAATTCATGAGCAAAGCAGG - Intronic
1174682428 20:52421660-52421682 CTGTAGTCCTTGAGTCAAAAAGG - Intergenic
1174830643 20:53809082-53809104 CTCCATTCATTGAGCAAAAAAGG - Intergenic
1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG + Exonic
1179078533 21:38147704-38147726 CTGCTGTCATAGAACAAAACTGG - Intronic
1180137652 21:45871618-45871640 CTGCAGTCCCTGAGCCTAACCGG + Intronic
1184366185 22:44052992-44053014 CTGCAGCCAGTGAGCAAATCTGG - Intronic
949182691 3:1153849-1153871 CTGGGATCCTTGAGCAAAGCAGG - Intronic
949202463 3:1395350-1395372 GTGCAGCCCTTGAGCACATCTGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
955121552 3:56064798-56064820 CTGCAGCCCATGGGCCAAACTGG + Intronic
957172264 3:76752691-76752713 CTGAAGTGTTTGAGGAAAACTGG + Intronic
961072627 3:123949050-123949072 CATCAGACCTAGAGCAAAACTGG - Exonic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967054475 3:185817516-185817538 CTAAAGTCCATGATCAAAACAGG + Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
971543400 4:27851690-27851712 CTGCATTCCATTGGCAAAACGGG + Intergenic
972013150 4:34209439-34209461 CTGCACCCCTGGAGTAAAACAGG + Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG + Intergenic
976638684 4:87313889-87313911 CTTCAGGCCTTGGGAAAAACTGG - Exonic
979243720 4:118474052-118474074 CTGCAGTGGTAGAGCAAAAGTGG - Intergenic
984186117 4:176545865-176545887 CTACAGCCCTTGAGGACAACTGG - Intergenic
984496615 4:180506039-180506061 CTGGATTCCTTGAACAAAATAGG + Intergenic
990683338 5:58270857-58270879 CTGCAATACTTGTGCAAGACAGG - Intergenic
995571945 5:113489945-113489967 TTGGAGACCCTGAGCAAAACTGG + Intergenic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1003017809 6:2482065-2482087 CTGCACCCCTTGAGCACATCGGG - Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1004321482 6:14634861-14634883 CCGTAGTCTTTGAGCAAAGCAGG + Intergenic
1005256758 6:24011501-24011523 ATACACTCCCTGAGCAAAACAGG + Intergenic
1005471938 6:26169834-26169856 CTGTAGTCCTTGAGCCAAGAGGG + Intronic
1007317814 6:41003433-41003455 GTGCACACCTTCAGCAAAACTGG - Intergenic
1008386958 6:50902639-50902661 CTGCAATGCTTGAACACAACTGG - Intergenic
1011263411 6:85491184-85491206 CTGCAGTCCATGAGATAAACAGG - Intronic
1013274314 6:108569713-108569735 CTGCAGTCCTAGGGCACATCTGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017740032 6:157398282-157398304 CTGCAGTCCTGGAGGGAACCTGG + Intronic
1023618445 7:42045169-42045191 CTGGTATCCTTGAGCTAAACAGG + Intronic
1025270439 7:57507733-57507755 ATGAAGTCTTTGAGCAAAGCAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026373061 7:69721201-69721223 CTGCAGTACTTGAGCAGATCAGG - Intronic
1026491274 7:70866105-70866127 CTGCAGTCCTACAGCAATGCAGG - Intergenic
1026509790 7:71018444-71018466 CTGCAGTCCTATGGCAATACAGG + Intergenic
1032154908 7:129459704-129459726 CTGCAGTCCTTTGGCCAAATAGG + Intronic
1034190462 7:149209456-149209478 CTGCAGTCCTTGATGAAGACAGG - Intronic
1036644907 8:10607011-10607033 CTGGAGTCCTTGAGCCCAAAGGG + Exonic
1036681288 8:10876261-10876283 CCTCAGTCCTTGAGCATAGCTGG - Intergenic
1037509882 8:19571768-19571790 CTACAGTCCCTCAGCAAAATGGG + Intronic
1038973886 8:32670174-32670196 CTGAAGTCCTGTAGCATAACAGG - Intronic
1039201990 8:35105236-35105258 CTGTATTCATTGAGGAAAACAGG + Intergenic
1039932926 8:42011104-42011126 CTGAAGCCCTTGAGTAAAAAGGG - Intronic
1043045613 8:75319928-75319950 CTGCAGTCATTGAGCAACACAGG + Intergenic
1044961671 8:97537421-97537443 ATTCAATGCTTGAGCAAAACAGG + Intergenic
1047885418 8:129245076-129245098 CTGCATTTCTTGATCTAAACTGG - Intergenic
1048871719 8:138804429-138804451 CTGCTGTGCTTGAGCAGAGCAGG - Intronic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053288801 9:36866615-36866637 CTCCTGTCCTTGTGCAGAACTGG - Intronic
1055689602 9:78815567-78815589 CTGCACTCCTTGAACAAGGCTGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056247829 9:84715109-84715131 CTGTACTCCTTGATCATAACAGG + Intronic
1188256952 X:27974269-27974291 CAACAGTCCTTGAGCCAAAATGG + Intergenic
1189171264 X:38911969-38911991 CTACAGTCAATGAGCAGAACTGG - Intergenic
1192331759 X:70181129-70181151 GTGCAGCCATTGAGGAAAACAGG - Intronic
1194585685 X:95731115-95731137 CTGGAGTCCTTGAGGTAAGCAGG + Intergenic
1199613879 X:149639946-149639968 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1199627888 X:149757702-149757724 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1200747766 Y:6917427-6917449 CCACAGGCCTTGACCAAAACGGG - Intronic
1202133627 Y:21637599-21637621 TTACATTCCTTTAGCAAAACTGG + Intergenic