ID: 1003566438

View in Genome Browser
Species Human (GRCh38)
Location 6:7226717-7226739
Sequence CTGAGGAGAGGAAGTTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003566438_1003566445 5 Left 1003566438 6:7226717-7226739 CCATGGGAACTTCCTCTCCTCAG 0: 1
1: 0
2: 0
3: 24
4: 277
Right 1003566445 6:7226745-7226767 CTTTCCTTAAAATGTCGGTTGGG 0: 1
1: 0
2: 1
3: 5
4: 149
1003566438_1003566444 4 Left 1003566438 6:7226717-7226739 CCATGGGAACTTCCTCTCCTCAG 0: 1
1: 0
2: 0
3: 24
4: 277
Right 1003566444 6:7226744-7226766 TCTTTCCTTAAAATGTCGGTTGG 0: 1
1: 1
2: 0
3: 13
4: 121
1003566438_1003566443 0 Left 1003566438 6:7226717-7226739 CCATGGGAACTTCCTCTCCTCAG 0: 1
1: 0
2: 0
3: 24
4: 277
Right 1003566443 6:7226740-7226762 GGTTTCTTTCCTTAAAATGTCGG 0: 1
1: 0
2: 4
3: 21
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003566438 Original CRISPR CTGAGGAGAGGAAGTTCCCA TGG (reversed) Intronic
900908199 1:5575644-5575666 CTGAGGAGCGGCAGCTACCATGG + Intergenic
901069259 1:6509126-6509148 CTCTGGACAGGAAGATCCCAGGG + Intronic
902553527 1:17233403-17233425 CTGAGGTCATGAAGTTCCCAGGG + Intronic
902786000 1:18733130-18733152 GGGAGGAGAGCAAGGTCCCAGGG - Intronic
903288124 1:22289790-22289812 CTCAGGAGAGGCAGGTCTCAGGG - Intergenic
903929515 1:26854265-26854287 CTGTGGAGAGGAAGCCTCCATGG + Exonic
904974414 1:34444893-34444915 CTGATGGGAGGAAGTTCCAGTGG + Intergenic
905175945 1:36135411-36135433 CGGAGGAGAGGAAGGGCCGAGGG + Intergenic
905351236 1:37347937-37347959 GAGAGGAGAGGAAGTGGCCAGGG - Intergenic
906025676 1:42671798-42671820 AAGAGGAGATGAATTTCCCATGG + Intronic
906099891 1:43253510-43253532 CTCAGGGGAGAAAGTTCTCAAGG + Intronic
906642787 1:47451378-47451400 CTGGGGAGAGGAAGTTGCTCTGG - Intergenic
907060349 1:51416204-51416226 CCCAGGAAAGGATGTTCCCAAGG - Intronic
907390198 1:54153073-54153095 GTGAGTAAAGGAAGTACCCAGGG - Exonic
909475106 1:76073573-76073595 CTGAAGACAGGAGCTTCCCATGG + Intergenic
910175955 1:84430481-84430503 CTGAGGAGATGAAGACTCCAGGG - Intergenic
910784769 1:90984231-90984253 CTGAAGACAGCAAGTTCTCAAGG + Intronic
911050089 1:93663616-93663638 CTAAGGAGAGGTAGTTCAAATGG + Intronic
912660846 1:111529307-111529329 TTGAGGTAAGGAAGTTCCAAAGG - Intronic
912704945 1:111904782-111904804 CTGGGGACAGGAAGTCACCATGG + Intronic
915147017 1:153801342-153801364 CTGAGGCCAGGGACTTCCCAGGG - Intergenic
915526422 1:156479179-156479201 GAGAGGAGAGGAAGATCCCAGGG - Intronic
920523042 1:206643478-206643500 CAGAGTAGGGGAAATTCCCAGGG + Intronic
921222313 1:212981778-212981800 ACGAGGAGAGGAAGTTCACAGGG - Intronic
921287618 1:213623020-213623042 CTGAAGATAGAAAGTTCCAAAGG - Intergenic
923477231 1:234345556-234345578 CAGAGGAGAGAAAGTACCCATGG + Intergenic
1062801574 10:385050-385072 CTGAGGAGAAGCAGCTCTCAGGG + Intronic
1063739145 10:8797823-8797845 GTGAGGAGAGGAATTTCCTTGGG - Intergenic
1064114386 10:12565779-12565801 ATGTGGAGAGGAAGTTACCCAGG + Intronic
1065272896 10:24054426-24054448 CTGAGGAGAGAAAGTAGCCCAGG + Intronic
1067461497 10:46461720-46461742 CTAAGAAGATGAGGTTCCCATGG + Exonic
1067625697 10:47922881-47922903 CTAAGAAGATGAGGTTCCCATGG - Intergenic
1069083549 10:64114101-64114123 CTGAGAAGAGGTAGTTTTCATGG + Intergenic
1069102046 10:64334367-64334389 CTCAGGAGAGGAATTTCGGAGGG - Intergenic
1070850242 10:79557352-79557374 CTGAGTAGCGGAAGTCTCCAGGG + Exonic
1070856983 10:79613948-79613970 CTGAGTAGCGGAAGTCTCCAGGG - Exonic
1073654609 10:105399641-105399663 CTCAGGAGGGGAAGTGGCCAAGG + Intergenic
1076315526 10:129537863-129537885 CAGAGGAGCCCAAGTTCCCAGGG - Intronic
1076504387 10:130962346-130962368 CTGAGTAGTGGGAGTACCCACGG + Intergenic
1079318568 11:19430805-19430827 CTGAGGAGCGGACCTTTCCACGG - Intronic
1081633272 11:44703430-44703452 CTGAGGACAGGAACATCCCTGGG - Intergenic
1082773881 11:57230959-57230981 CTGGGCAGAGGAATTGCCCACGG - Intergenic
1083336274 11:61923633-61923655 CTGACCTGAGGAAGTTCACAGGG - Intergenic
1083413050 11:62506778-62506800 CTCAGGAGAGGAAGGACCCAGGG + Intronic
1083616737 11:64029942-64029964 GGGAGCAGAGGAAGCTCCCAAGG + Intronic
1084358648 11:68655617-68655639 CTGATTAGAGGGCGTTCCCATGG + Intergenic
1085478195 11:76801030-76801052 CAGAGACGAGTAAGTTCCCATGG + Intergenic
1085643633 11:78208871-78208893 ATGCGGAGAGGAAGTTCTCTGGG - Exonic
1086249351 11:84795268-84795290 CTGCAGAGAGGAGCTTCCCAAGG + Intronic
1089959782 11:122605979-122606001 CTCAGGAAAAAAAGTTCCCATGG - Intergenic
1090403249 11:126462233-126462255 GTGTGGAGAGGATGTTACCAGGG + Intronic
1090553710 11:127851182-127851204 AAGAGGGGTGGAAGTTCCCAAGG - Intergenic
1090622777 11:128576138-128576160 CTGACAAGAGGGAGTTGCCAGGG + Intronic
1092446338 12:8560946-8560968 CTGAGCAGAAAAAGTTTCCAAGG + Intergenic
1092522870 12:9291717-9291739 GTGAGCTGAGGAAGTTCCTAAGG - Intergenic
1092544418 12:9440180-9440202 GTGAGCTGAGGAAGTTCCTAAGG + Intergenic
1094508532 12:31081887-31081909 GTGAGCTGAGGAAGTTCCTAAGG - Intronic
1095824560 12:46517420-46517442 CTGATGAGAGGAACTCTCCAAGG - Intergenic
1095921833 12:47539529-47539551 CTGAGGAAAGGGAGGTACCAAGG + Intergenic
1096080257 12:48828144-48828166 GGGAGGAGAGGAAGGTGCCAGGG - Exonic
1096497324 12:52045993-52046015 CCGAGGAGGGGAAGCTCCCAGGG + Intronic
1096581187 12:52586431-52586453 ATGAAGAGAGGCACTTCCCAGGG + Intronic
1099933046 12:89095555-89095577 ATGGGGAGAGGAAGTTCAGATGG - Intergenic
1101984357 12:109433922-109433944 CTGGTGAGGGAAAGTTCCCAGGG - Intronic
1102104975 12:110313613-110313635 CTTAGGAAAGGTGGTTCCCATGG - Intronic
1103468627 12:121162359-121162381 CTGCGGAGAGGACGTTCTCCAGG - Intronic
1104224126 12:126814383-126814405 CTTAGCAGAGGAATTTCCAAAGG + Intergenic
1106470679 13:30051626-30051648 CTGAGGAGTGGAAGGTGACAGGG - Intergenic
1111729294 13:92052802-92052824 CAGAGGTGAGGAAGTTGCAAAGG + Intronic
1112177773 13:97044744-97044766 CTCAGGGGAGGAAGTTACCCTGG + Intergenic
1112311672 13:98322671-98322693 CTGAGTAGAGGCTGTTCCCCGGG + Intronic
1113222951 13:108126337-108126359 CTGAGGAAAGGAAGATGCAAAGG - Intergenic
1113388633 13:109874170-109874192 CAGAGAAGAGCAAGTTCCCCTGG - Intergenic
1113732521 13:112651955-112651977 CTAAGGAGAGGAATTTCTCTTGG - Intronic
1114490251 14:23095942-23095964 CAGAAGAGAGTAAGTTCCCTTGG + Intronic
1114725107 14:24928125-24928147 GTGAGAAGAGGAAGTTCGTAGGG - Intronic
1118157885 14:63258558-63258580 CTGAGGAGAGAAAGCACCCTTGG + Intronic
1118462391 14:65998951-65998973 CTAACAAGAGGAAGCTCCCAGGG + Intronic
1118752887 14:68819459-68819481 CTGAGGTGAGGAAGGCCCCAGGG + Intergenic
1119286179 14:73457594-73457616 CAGGGGAGTGGAAGTTCCCTCGG - Intronic
1120323290 14:82993299-82993321 AAGAGGACAGGAGGTTCCCAAGG + Intergenic
1120340240 14:83210443-83210465 TTAAGGAGAGTAAGGTCCCATGG + Intergenic
1121179598 14:91918939-91918961 CAGAGAAGAGGAGGTTCCAATGG + Intronic
1121329471 14:93040872-93040894 GTGAGGTGAAGTAGTTCCCAGGG - Intronic
1121408036 14:93730884-93730906 CTGAGGGTAGCAGGTTCCCAGGG + Intronic
1121683155 14:95811078-95811100 CTGAGTAGAGGAATTTGCCCGGG + Intergenic
1122508178 14:102245511-102245533 CTGAGAAAAGGAATTTCACAAGG - Intronic
1122541087 14:102497946-102497968 CTGAGGGTACGAAGTTCACATGG + Intronic
1122722992 14:103732454-103732476 CTGAGGAGATGGTGTTCCCTGGG + Intronic
1122849613 14:104520635-104520657 CTGAAGGGAGGAATTTCTCATGG - Intronic
1123987556 15:25658727-25658749 CCGAGGGGAGGAAGCTTCCACGG + Intergenic
1126152428 15:45535652-45535674 CTAAGGAGAAGGGGTTCCCAAGG - Intergenic
1126711267 15:51459271-51459293 CTGATGAGAGGAAGATGCAATGG + Intronic
1127346801 15:58109202-58109224 CTGTGCAGAACAAGTTCCCATGG + Intronic
1128081235 15:64858139-64858161 CTGAGCTGAGGCAGTTGCCAAGG + Intronic
1128702164 15:69812773-69812795 CTGAGCAGGGGAGGTTACCATGG - Intergenic
1128788922 15:70418430-70418452 CTGAAGAGATGAAGTTCCAACGG - Intergenic
1129125535 15:73437687-73437709 GTGAGAAGGGGATGTTCCCATGG - Intergenic
1129199117 15:73988361-73988383 CTGAGAAGAGGAAGTGGCCCCGG - Intronic
1129639316 15:77358050-77358072 CTGAGGGAAGGAAGTGCTCATGG - Intronic
1131071332 15:89468061-89468083 CAGAGGAGAGGAACTTACCCAGG + Intergenic
1131196419 15:90358922-90358944 TTGAGGCGAGGAAGATCCCGAGG + Exonic
1132092953 15:98960507-98960529 CTGAGGAGAGGAAGGTGTCCAGG + Exonic
1132870447 16:2113398-2113420 CAGAGGAGAGGAGGTGCCCGGGG + Intronic
1132905849 16:2282617-2282639 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905873 16:2282691-2282713 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905897 16:2282765-2282787 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905920 16:2282839-2282861 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905943 16:2282913-2282935 CTGAGGAGAGGTGGTGCCCAGGG - Intronic
1133954250 16:10426448-10426470 CTGAGGAGAGGTATTTCACCTGG - Intronic
1134522093 16:14923527-14923549 CAGAGGAGAGGAGGTGCCCGGGG - Intronic
1134709762 16:16322178-16322200 CAGAGGAGAGGAGGTGCCCGGGG - Intergenic
1134949841 16:18346467-18346489 CAGAGGAGAGGAGGTGCCCGGGG + Intergenic
1135880476 16:26250746-26250768 CTGAGGAGTGGATGTTCTCCAGG + Intergenic
1136994692 16:35181658-35181680 CTGAGAAGAGCCAGCTCCCAGGG + Intergenic
1138292929 16:55863307-55863329 CTGAGGAGAGGAAGGTGGCAAGG + Intronic
1139526416 16:67519433-67519455 GTGAGGAGAGACAGGTCCCACGG + Intronic
1142758265 17:2028439-2028461 CTGATGAGGGAAAGGTCCCAAGG + Intergenic
1143102683 17:4513055-4513077 CTGAGGACAGGAGGTCCCCGGGG + Intronic
1143239698 17:5433595-5433617 ATAGGGACAGGAAGTTCCCAAGG + Intronic
1143772079 17:9175291-9175313 GTGAAGAGAGGGAGTACCCAGGG - Intronic
1145887159 17:28390292-28390314 TTGTGCAGAGGAAGTTCTCAGGG + Intronic
1146498392 17:33343395-33343417 CAGAGGCGAGGAAGTGTCCAAGG - Intronic
1147137800 17:38444155-38444177 ATGGGGAGGGGAAGATCCCAGGG + Intronic
1147327712 17:39677678-39677700 CTGAGGAGAGGGGGTGGCCAGGG + Intronic
1149348535 17:55764061-55764083 ATGAGAACAGGAAGTTCTCAAGG - Intronic
1150620811 17:66806594-66806616 CAGAGAGGAGGAAGATCCCACGG + Exonic
1151021438 17:70621855-70621877 CTGGGGAGAGCAAGATACCAGGG + Intergenic
1151517768 17:74607413-74607435 CTCAGGAGAGGAAGTGCTCAAGG - Intergenic
1152563704 17:81090957-81090979 CTGAAGAGAGGAAGCACCCTGGG + Intronic
1152600619 17:81260395-81260417 CTGAGGAGACAAAGACCCCAGGG + Intronic
1154134904 18:11768132-11768154 CTGAGGACAGGAACTTGACATGG + Intronic
1155489560 18:26386587-26386609 GTCAGGAGAGTGAGTTCCCATGG - Intronic
1156653926 18:39260840-39260862 CTGGGTAGAGGAGGTTCCCTTGG - Intergenic
1157202586 18:45671817-45671839 CTGAGGAGAGGCAGTGTCCTGGG - Intronic
1157779099 18:50421290-50421312 CTGAGCAGGGGAGGTTCCCCCGG + Intergenic
1158274153 18:55748329-55748351 CTGAAGAGAGAAAGTGCCCTTGG - Intergenic
1158303549 18:56079560-56079582 CTGGGGAGAGTGACTTCCCAGGG + Intergenic
1158385123 18:56980770-56980792 CTGAGGTGAGGAAGATCTTAGGG + Intronic
1158598646 18:58838404-58838426 CTCAGGAGAGGTATGTCCCAGGG - Intergenic
1158798368 18:60876064-60876086 TGGATGAGAGCAAGTTCCCAAGG + Intergenic
1161683298 19:5691215-5691237 CAGAGGGGAGGAAGTAGCCAGGG + Intronic
1161844308 19:6703193-6703215 TTATGGAGAAGAAGTTCCCAAGG - Intronic
1163183725 19:15622030-15622052 ATTAGGAGATGAAGATCCCATGG - Intronic
1163287032 19:16355389-16355411 TCGAGGAGAGGAAGCACCCAGGG - Exonic
1163324658 19:16595378-16595400 CAGAGGAGAGGAAGACCACAGGG - Intronic
1163386946 19:17005600-17005622 CTCAGGAGTGGAAGATCCCCTGG - Intronic
1163532892 19:17861081-17861103 CTGAGGAGAGGGAGGTCTCCAGG - Intronic
1164673603 19:30087645-30087667 GTGAGGAGAGGATGTTCTCTTGG + Intergenic
925398826 2:3557617-3557639 TTGGGGTCAGGAAGTTCCCAGGG - Intronic
928310184 2:30203336-30203358 CTGAGGAACTGATGTTCCCAAGG + Intergenic
929311370 2:40429837-40429859 CTCAGGAGCAGAAGATCCCAGGG + Exonic
929954440 2:46444581-46444603 CTGCAGAGAGGAGGTTTCCAAGG - Intronic
931786236 2:65621694-65621716 CACAGGAAAGGAAGTTCCCCAGG - Intergenic
934783795 2:96990037-96990059 CAGAGGAGAGGAAGGTACCCAGG - Intronic
935707922 2:105872402-105872424 GTGAGGACAGGAAGTACCCGTGG - Intronic
936236678 2:110748182-110748204 CTGAGGAGAGGAATGGGCCAAGG + Intronic
938307917 2:130267202-130267224 CAGAGGAGAGGATGGTCCCAAGG + Intergenic
938416397 2:131106338-131106360 CTGAGGGGAGGAATATTCCAAGG + Intronic
938447416 2:131389639-131389661 CAGAGGAGAGGATGGTCCCAAGG - Intergenic
940376661 2:152965796-152965818 CAGAGGAGAGGAACTTGCCCAGG - Intergenic
942995864 2:182259058-182259080 CTGAGTAGAGGGACTTTCCAAGG - Intronic
943228310 2:185209885-185209907 CTGAGAAGAGGATGTTGACAAGG + Intergenic
943781769 2:191831632-191831654 CTTATGAGAGGAAGTGTCCAAGG + Intergenic
946174261 2:217912948-217912970 ATGAGGAGACGGAGTTTCCAGGG + Intronic
1168987478 20:2062661-2062683 CTGAGGATAGGAAATTGCCTGGG + Intergenic
1169097997 20:2920593-2920615 CTGAGGAGAGGAAATTCTGAGGG + Intronic
1173578190 20:44126664-44126686 GTGGGGAGAGGAAGGTCCCATGG - Intronic
1174693137 20:52529514-52529536 CTGAGGAGAGGATGTCCCTATGG - Intergenic
1175055608 20:56194728-56194750 ATGAGGAGAAGCATTTCCCAGGG - Intergenic
1176297159 21:5080225-5080247 CTGAGAATGTGAAGTTCCCAAGG - Intergenic
1177831897 21:26148433-26148455 CTGAGAAGAGGAAGGTCAGATGG + Intronic
1179859869 21:44181722-44181744 CTGAGAATGTGAAGTTCCCAAGG + Intergenic
1180227359 21:46402738-46402760 CTGAGGAGAGGCACTTCCCTAGG + Intronic
1180962754 22:19769638-19769660 CTGTGGAGGTGACGTTCCCATGG + Intronic
1181507552 22:23370317-23370339 CTGAGGAGAGGAAGCTAGCAAGG + Intergenic
1181840846 22:25659154-25659176 CAGAGGAGAGGAACTACCAAAGG + Intronic
1182249203 22:28986339-28986361 CTGAGAAGAGGAAATCCTCAGGG - Intronic
1183618424 22:38959081-38959103 CTGGGGAGAGGAACCTGCCAGGG - Intronic
1183671893 22:39278021-39278043 CTGAAGAGAGGATGTCCCCAAGG + Intergenic
1184091956 22:42297551-42297573 CTGGGGAGGGGCAGTTCACAGGG + Intronic
1184745640 22:46454141-46454163 GTGAGGTGAGGAAGGTGCCAGGG + Intronic
1185060327 22:48603217-48603239 CTGAGGACAGGCAGTGCGCATGG - Intronic
1185398278 22:50603576-50603598 CTGAGGAGGGCCAGCTCCCAGGG - Intronic
949506990 3:4737662-4737684 CTGAGGAAAGCAGGGTCCCAAGG + Intronic
950313034 3:11975625-11975647 CTGAGTAGAGTAGGCTCCCATGG + Intergenic
950888560 3:16382522-16382544 GTGAGTAGAGGAAGTCACCAAGG - Intronic
950930349 3:16783204-16783226 GTGAGGAGAAGTAGTTCCCAGGG + Intergenic
952879438 3:37974303-37974325 GAGAGGAGAGGATGTTCCCACGG + Intronic
953528127 3:43712494-43712516 ATGAGGGAAGGAAATTCCCATGG - Intronic
954252206 3:49376705-49376727 CTGATGAAAGGGAGTACCCAAGG + Intronic
954276674 3:49546656-49546678 CTGATGAAAGGGAGTACCCAAGG - Intergenic
956967904 3:74484737-74484759 CTGAGGAGAGGAAGGTGGCCAGG - Intronic
958065194 3:88536022-88536044 ATGAGAAGAGGAAGGCCCCATGG + Intergenic
959605566 3:108237486-108237508 CTGGGCAGAGGCAGTTCCCCTGG + Intergenic
961041458 3:123681513-123681535 CTGAGGTGAGGAAGAACTCAGGG + Intronic
961751200 3:129095828-129095850 CTGTGGAGAAGAGGTGCCCATGG + Intronic
962925391 3:139988612-139988634 CTGAGGAGAAGCACTTGCCATGG + Intronic
968653997 4:1770875-1770897 CGGAGGAGAGGAAGCCCTCAGGG - Intergenic
968903019 4:3440008-3440030 CTGAGGAGGAGAAGTGCCCCAGG + Intergenic
970555343 4:17225891-17225913 CTGAGCAGGGGAGGTTCCCCTGG + Intergenic
971332602 4:25694639-25694661 CTCAGGACAGGAAGTTCCTGTGG + Intergenic
975008663 4:69322007-69322029 CTGAGTAGAAGAAGGTCCTATGG + Intronic
975495438 4:75031054-75031076 CTCAGGTGTGGAACTTCCCAGGG + Intronic
976930330 4:90559494-90559516 TTGAGGAGAGGAAGTCCCTTCGG + Intronic
978431584 4:108638779-108638801 CTGTGGAGAGGAAGGGACCAAGG - Intergenic
978470792 4:109065146-109065168 TTGAGGAGGGGAAGTGCTCAGGG + Intronic
981008074 4:139896230-139896252 TTGAGGAGAGGAAAGTCACAGGG - Intronic
981658417 4:147138394-147138416 CTGGGGAGAAGATGTCCCCAGGG + Intergenic
982066181 4:151656800-151656822 CTGTGGAGAGAGACTTCCCAGGG + Exonic
982443067 4:155459144-155459166 CTGAGGAGTTGAAGTTCTCCTGG + Intergenic
982466784 4:155742096-155742118 CTAGGTAGAGGAAGTTCCAATGG + Intergenic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
986329552 5:6707433-6707455 CTGAGGACAGAAATTCCCCAGGG - Intergenic
988428287 5:31089539-31089561 GTGAGGAGCTGAGGTTCCCAGGG + Intergenic
989606053 5:43245669-43245691 CTGAGGACAGCAGGTGCCCAGGG - Exonic
990510653 5:56486531-56486553 CAGTGGAGAGGAAGGTTCCATGG - Intergenic
990608683 5:57436280-57436302 CTGAAGCGAGGGAGTTCACATGG + Intergenic
993073090 5:83190643-83190665 CTGAGGAGAGGAGATTATCAAGG - Intronic
993211818 5:84961848-84961870 CTGCAGAAAGGAACTTCCCATGG - Intergenic
994300850 5:98145675-98145697 CAGAAGAGAGGAAAATCCCAGGG - Intergenic
994386696 5:99141800-99141822 CTTGGGAGAGGAGGTTACCAGGG - Intergenic
994983503 5:106905622-106905644 TTGAGGAGAGGAAGTAATCAAGG - Intergenic
995027641 5:107442903-107442925 CCGAGGAGCGAAAGTTCCCCAGG + Intronic
995422640 5:111984278-111984300 CTGAAAGGAGGAAGTGCCCAAGG + Intronic
999240444 5:150124500-150124522 CTGAGGAGGGGAAGAGGCCAGGG + Intronic
1000169702 5:158690096-158690118 CTGAGGAGAAGAATTCCCCAGGG + Intergenic
1001004595 5:168039015-168039037 CTGAGGGGAGAAAGTGCCCTAGG + Intronic
1001315683 5:170639680-170639702 AGGAGGAGAGGAAGGTTCCAAGG - Intronic
1001590534 5:172861416-172861438 CTGAGGAACCGAGGTTCCCATGG - Intronic
1003566438 6:7226717-7226739 CTGAGGAGAGGAAGTTCCCATGG - Intronic
1004378211 6:15109150-15109172 CTGAGGTTTTGAAGTTCCCACGG - Intergenic
1004674241 6:17825718-17825740 GTGAGGTGAGGAAATGCCCAAGG + Intronic
1005186173 6:23165198-23165220 CTGAGCAGAAAAAGTTCTCAAGG - Intergenic
1006281041 6:33053530-33053552 CTGAGTAGAAAAAGTTTCCAAGG - Intergenic
1006635365 6:35457784-35457806 CAGAGAAGAGGAAGTTACCTGGG - Intronic
1006795955 6:36732519-36732541 AGGAGGAGAGAAACTTCCCAAGG + Exonic
1007125350 6:39421640-39421662 CTGTGGACAGGAGGTTTCCAGGG + Intronic
1007634784 6:43292856-43292878 TAGAGGAGAGGACATTCCCAGGG + Intergenic
1007757154 6:44107274-44107296 CTGAGGAGCAGGACTTCCCAAGG - Intergenic
1008046246 6:46854326-46854348 CAGAGGACAGGAAGATCTCAAGG + Intronic
1008058652 6:46973655-46973677 GTGATGACTGGAAGTTCCCAAGG - Intergenic
1008501475 6:52187682-52187704 CTGAGGACAAGAACTTCCCCCGG + Exonic
1010421562 6:75682114-75682136 CTGAGGAAAGAAAATTACCAGGG + Intronic
1011536786 6:88384148-88384170 GTGAGGAGAGGAAGATACCTAGG + Intergenic
1012610452 6:101212440-101212462 CTGAGGTGAGGAAGCTCAGAAGG - Intergenic
1013632968 6:112002690-112002712 CTGGAGAGAGGAGGATCCCAGGG + Intergenic
1016654573 6:146503222-146503244 CAGAGGAGAGGCAGAGCCCAAGG - Intergenic
1016939890 6:149474964-149474986 CTGGGGTGAGGAATTTACCATGG - Intronic
1017536321 6:155350569-155350591 CTGGGTAGAGGAGGTTCCCCTGG + Intergenic
1018906728 6:168079976-168079998 GTCAGGAGAGGCAGTTCCCACGG + Intronic
1023202742 7:37716515-37716537 ATGAGGAGAGGTAATGCCCAGGG + Intronic
1023986430 7:45099847-45099869 CAGAGCAGAGGAGCTTCCCAGGG - Intergenic
1024448782 7:49514214-49514236 CAGAGAACAGGAAGTTACCAAGG + Intergenic
1025097522 7:56107847-56107869 TTGAGGAGAGGAAGCACACATGG + Intergenic
1025998247 7:66541993-66542015 CCCAGGAGATGCAGTTCCCAAGG + Intergenic
1027161676 7:75807223-75807245 GGGAGCAGAGTAAGTTCCCATGG - Intergenic
1027888201 7:83936616-83936638 CTGATGAGAGCAAGTTCCCTAGG + Intergenic
1028493715 7:91441514-91441536 CACAGGAGAGGAGCTTCCCAAGG + Intergenic
1029674954 7:102062194-102062216 CTGAGGAGGGAAAGCACCCAGGG + Intronic
1030051137 7:105538597-105538619 CAGAGGAGCTGACGTTCCCATGG - Intronic
1031020851 7:116626016-116626038 AAGAGCAGAGGAGGTTCCCAAGG - Intergenic
1032142796 7:129348903-129348925 CTAAGGAAGGGAAGGTCCCATGG + Intronic
1033356576 7:140605477-140605499 GTGAGGAGAGGATGATCCCTTGG - Intronic
1034744730 7:153513771-153513793 CTCAAGAGAGGAGGCTCCCAAGG - Intergenic
1037355702 8:18017546-18017568 CTCATTAGATGAAGTTCCCAAGG + Intronic
1037584282 8:20265809-20265831 CAGAGGGCAGGAAGTTCCCTTGG + Intronic
1037804996 8:22054164-22054186 CTGAGGAGTGGTAGCTGCCAAGG - Intronic
1040359836 8:46654607-46654629 CTGAGGGGAAAAAGTTTCCAAGG - Intergenic
1041352531 8:56962415-56962437 CTGATGAGAGGGATTTCTCACGG - Exonic
1041623813 8:60002092-60002114 CTAAGGTGGGGAAGTTCTCATGG - Intergenic
1043523862 8:81074826-81074848 CTGAGGTTAGGAAATTCCCTGGG + Intronic
1043592659 8:81848215-81848237 CAGAGGAGAGGAACTTACCCAGG + Intergenic
1045232516 8:100318019-100318041 CTGAGGGGAGGAAGGAGCCATGG - Intronic
1047030982 8:120880285-120880307 CAGAGGAGGGGAAGCTCACAAGG + Intergenic
1048547935 8:135404595-135404617 CTGTGGAGAGGAGCTACCCATGG - Intergenic
1049280204 8:141740290-141740312 CAGAGGAGGGGCAGTGCCCACGG - Intergenic
1050449191 9:5761913-5761935 CTGAGGAGAGGCAGATTTCATGG - Intronic
1052380356 9:27764307-27764329 CTGACGAGGAGAAGATCCCATGG - Intergenic
1053032502 9:34793267-34793289 TTGAGGTAAGGAAGTTCCAAAGG - Intergenic
1057149933 9:92787535-92787557 CCAAGGAGAGAGAGTTCCCAGGG - Intergenic
1058110817 9:101029259-101029281 CAGAGGAGAGGACGAACCCAGGG + Intronic
1058767330 9:108194566-108194588 TTGAGGAGATGAAGGTTCCAAGG - Intergenic
1060044205 9:120327207-120327229 CTGGGGAGGGGAAGTGGCCAGGG + Intergenic
1060212510 9:121719226-121719248 ATGAGGAGGGGATGTACCCAAGG + Intronic
1060676263 9:125517844-125517866 CTGAGAAAAGCAAGGTCCCAAGG - Intronic
1061591722 9:131602235-131602257 CTGTGGAGTGCAAGTTCCTATGG + Intronic
1062161746 9:135084112-135084134 CTGCCGAGAGGGAGTGCCCAGGG + Intronic
1062325665 9:136011290-136011312 CTCCTGCGAGGAAGTTCCCAGGG - Exonic
1062510085 9:136900399-136900421 CTGGGGAGAGGAATATCCCTCGG - Intronic
1203616184 Un_KI270749v1:67589-67611 CTGAGGAGAGGGATTCGCCAAGG - Intergenic
1185456317 X:312618-312640 CCCAGGAGAGGGGGTTCCCATGG - Intronic
1185836732 X:3351613-3351635 CAGATGAGGGCAAGTTCCCATGG - Intergenic
1186249155 X:7647377-7647399 ATGATGATAGGAAGCTCCCAAGG - Intergenic
1186454978 X:9703665-9703687 TGGAGGTGTGGAAGTTCCCACGG - Intronic
1192168898 X:68842492-68842514 TGGAGGAGGGGATGTTCCCATGG + Intergenic
1192717747 X:73661746-73661768 CTGAGCAGAAAAAGTTTCCAGGG + Intronic
1195159607 X:102157923-102157945 CTGGGCTGAGCAAGTTCCCAAGG + Intergenic
1198530052 X:137543683-137543705 CTGAGCAGAGGATTTTCCTAAGG - Intergenic
1199709702 X:150460497-150460519 CAGTGGAGAGGCAGGTCCCAAGG + Intronic
1200286727 X:154830030-154830052 CTGAGGAGAGGGAGTATCCCAGG + Intronic
1200398643 X:156006060-156006082 CTGTGGACAGGAAGGGCCCAGGG - Intronic