ID: 1003573184

View in Genome Browser
Species Human (GRCh38)
Location 6:7269238-7269260
Sequence GTGGCTGGACAGAGGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 2, 3: 62, 4: 483}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003573172_1003573184 20 Left 1003573172 6:7269195-7269217 CCAGACGCCCCGCCAGGCACTTC 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG 0: 1
1: 0
2: 2
3: 62
4: 483
1003573177_1003573184 8 Left 1003573177 6:7269207-7269229 CCAGGCACTTCCCTACTGGTGCA 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG 0: 1
1: 0
2: 2
3: 62
4: 483
1003573174_1003573184 12 Left 1003573174 6:7269203-7269225 CCCGCCAGGCACTTCCCTACTGG 0: 1
1: 0
2: 1
3: 12
4: 184
Right 1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG 0: 1
1: 0
2: 2
3: 62
4: 483
1003573176_1003573184 11 Left 1003573176 6:7269204-7269226 CCGCCAGGCACTTCCCTACTGGT 0: 1
1: 0
2: 1
3: 8
4: 157
Right 1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG 0: 1
1: 0
2: 2
3: 62
4: 483
1003573179_1003573184 -3 Left 1003573179 6:7269218-7269240 CCTACTGGTGCATGAAGTGTGTG 0: 1
1: 0
2: 0
3: 12
4: 107
Right 1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG 0: 1
1: 0
2: 2
3: 62
4: 483
1003573173_1003573184 13 Left 1003573173 6:7269202-7269224 CCCCGCCAGGCACTTCCCTACTG 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG 0: 1
1: 0
2: 2
3: 62
4: 483
1003573178_1003573184 -2 Left 1003573178 6:7269217-7269239 CCCTACTGGTGCATGAAGTGTGT 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG 0: 1
1: 0
2: 2
3: 62
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003573184 Original CRISPR GTGGCTGGACAGAGGCAGCA GGG Intronic
900250097 1:1664432-1664454 AGGGCTTGTCAGAGGCAGCATGG - Exonic
900261128 1:1730338-1730360 AGGGCTTGTCAGAGGCAGCATGG - Intronic
901128950 1:6950159-6950181 CTGGCTGGGCGGAGGCAGCAAGG + Intronic
901448648 1:9323169-9323191 GTGCCGGGACAGAGGCCCCATGG - Intronic
901491720 1:9600062-9600084 GTGGCAGGGCAGAGGTAGCACGG + Intronic
901535162 1:9877960-9877982 GTGGCTGGGCAGAAGTAGGAAGG + Exonic
901703775 1:11059240-11059262 GTGGCTGCAGAGAGGCAGGTTGG + Exonic
901771451 1:11532284-11532306 GTCTCTGCACGGAGGCAGCAGGG - Intronic
901813138 1:11778977-11778999 GCAGCTGGGCAGCGGCAGCAGGG + Exonic
902799029 1:18818125-18818147 CTGGCAGGGCTGAGGCAGCAGGG + Intergenic
902830815 1:19011076-19011098 GTGGTTGAACACAGGCTGCAGGG - Intergenic
903138426 1:21324318-21324340 CTGGGTGGGCAGAGGAAGCAGGG + Intronic
903168937 1:21540313-21540335 GTGGCAGGAGAGAAGCAGCAGGG - Intronic
903186685 1:21633255-21633277 GAGGCTGGAGGGAGTCAGCAGGG - Intronic
903238761 1:21968498-21968520 GTGGCTGGGCAGGGGCAGGCTGG + Intergenic
903242686 1:21994162-21994184 GTGGCTGGGCAGGGGCAGGCTGG + Intronic
903337987 1:22637598-22637620 GTGTCTCCACAGAGGCATCATGG + Exonic
903776168 1:25795209-25795231 GGGGATGGACAGAGGAAGGAGGG - Intergenic
903945313 1:26959329-26959351 GTGGCGGGGCGGTGGCAGCAGGG - Intronic
904274208 1:29369705-29369727 GGGGCTGGACAGCAGCACCAGGG - Intergenic
904277698 1:29394978-29395000 GCAGGTGGACAGAGGCAGGAAGG + Intergenic
904293705 1:29504191-29504213 TTGGCTGCCCAGAGGCAGGAGGG - Intergenic
904423756 1:30410384-30410406 GGGGCTGGACAGCAGCACCAGGG + Intergenic
905226817 1:36484259-36484281 GTAGCTGGAGCAAGGCAGCAAGG - Intergenic
906406290 1:45545028-45545050 GTGGCTGCTGAGAGCCAGCAAGG - Intergenic
906638508 1:47426791-47426813 GTGCCTTGACAAAGGCTGCATGG - Intergenic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
907904616 1:58773093-58773115 ATGGCTGGAGAGTGGCAGCATGG + Intergenic
908490508 1:64638928-64638950 GGGGTTGGACAGAGCCAGCGAGG + Intronic
908751934 1:67431919-67431941 GGTGCAGGACTGAGGCAGCAGGG - Intergenic
909151355 1:72010074-72010096 CTGGCTGGACAGTGGCAGAGGGG - Intronic
910506696 1:87957564-87957586 GTTGCTGGGGAGAGGCAGCGTGG - Intergenic
911130704 1:94384838-94384860 GTGGCGGCTCAGAGGCTGCAGGG + Intergenic
912385047 1:109267291-109267313 GTGGCTGGAGACAGGCAGGATGG + Intronic
912451796 1:109771990-109772012 GTGTGTGCACAGAGCCAGCATGG + Intronic
912559066 1:110537376-110537398 GAGGCTGGGCACAGGTAGCAAGG + Intergenic
914197194 1:145453672-145453694 ATGGCTGGCCTGAGCCAGCATGG - Intergenic
914716601 1:150259464-150259486 GTGGGTGGGCACAGGCAGCCAGG - Intronic
914876186 1:151514029-151514051 GGGGCGGGACCAAGGCAGCAGGG - Intronic
916279723 1:163036245-163036267 GTTTCTGCCCAGAGGCAGCATGG + Intergenic
916556239 1:165896471-165896493 GGGGCTGGACTGACGCAGCCGGG - Intronic
916766068 1:167861919-167861941 GTGGCAGGAGAGAGCGAGCAAGG - Intronic
918220341 1:182430932-182430954 GTGGCTGAACAAAGTCATCAGGG - Intergenic
918682793 1:187375995-187376017 GTGGCTGGCCAGAGGGAGAGTGG - Intergenic
919914880 1:202133097-202133119 AGGGCTGGGTAGAGGCAGCAAGG - Exonic
920502266 1:206492884-206492906 CTGGCAGGGCAGAGGCAGCGAGG + Exonic
920528995 1:206688054-206688076 GTGGAGGGAGAGAAGCAGCAGGG - Intronic
921312261 1:213855967-213855989 CTGCCTGGGCAGAGGCTGCAGGG + Intergenic
921515106 1:216081126-216081148 GTGGCTGGACTGATGGATCAAGG + Intronic
922717939 1:227886752-227886774 GTGGGTGGAGAGAGGCGGAACGG + Intergenic
922960881 1:229644675-229644697 GTGCCTAGTCAGAGGGAGCAGGG + Intronic
923429365 1:233905481-233905503 GTGGGTGGGCAGGGGGAGCATGG - Intronic
1063376699 10:5558405-5558427 GAGCCTGGGCGGAGGCAGCAGGG + Intergenic
1063497130 10:6520395-6520417 AAGGCTGGACAGAGGAGGCAGGG - Intronic
1063666088 10:8061586-8061608 GTGACAGACCAGAGGCAGCAAGG + Intronic
1063894098 10:10661151-10661173 ATGGCTGGAAAGGGGCAGGAAGG - Intergenic
1065487605 10:26249877-26249899 CTGCCAGGACAGAGGCAGGAGGG + Intronic
1066312055 10:34206618-34206640 GTGGGTGGAGAGAAGCAGCTCGG + Intronic
1067188472 10:44050093-44050115 GTGGGTGGACAGAGCAACCAAGG - Intergenic
1067449763 10:46375156-46375178 GTGGCTGGGCAGAGCCAGGCAGG + Intergenic
1067555597 10:47267720-47267742 GGGGCAGGAGGGAGGCAGCAAGG - Intergenic
1067877722 10:50019973-50019995 GTGCCTTGACCGAGGCAGAAGGG - Intergenic
1069416765 10:68207514-68207536 GTGGGTGGCCCGCGGCAGCAAGG - Intronic
1069967777 10:72135699-72135721 GAGGCAGGACAGAAGCAGGAAGG + Intronic
1070384993 10:75916383-75916405 CTGGCAAGAGAGAGGCAGCAGGG + Intronic
1070395228 10:76006377-76006399 ATGGCCGGACAGAGGCAAAACGG - Intronic
1070780059 10:79132446-79132468 TGGGCTGGAGTGAGGCAGCAGGG + Intronic
1070913439 10:80137460-80137482 GCCTCTGGACAGAGCCAGCAGGG + Intronic
1072317818 10:94220927-94220949 GAAGCTGGAGGGAGGCAGCACGG - Intronic
1072470206 10:95706734-95706756 ATGGGTGGTCATAGGCAGCAGGG + Intergenic
1075598601 10:123750353-123750375 GTGGCTGGAGAGAGGCCGGCTGG - Intronic
1075633650 10:124016177-124016199 GGGGCTGGCCAGAGGCAGAGGGG + Intronic
1075642562 10:124075344-124075366 CTGGCTGGGGAGAGACAGCAGGG - Intronic
1076228037 10:128796647-128796669 GTGGCTGCCCAGAGGCACGATGG - Intergenic
1076607672 10:131700160-131700182 GGAGGTGGACAGAGGCACCAGGG - Intergenic
1076861474 10:133140147-133140169 GGGGCAAGACAGGGGCAGCACGG - Intergenic
1076991643 11:279009-279031 GTGGAAGGACAGAAGCAGAAAGG + Intronic
1077264230 11:1641184-1641206 CTGGCTGGACAGAGACGCCAGGG - Intergenic
1077280738 11:1744182-1744204 GTGGGTGGACAGAGGACACATGG - Intronic
1077316183 11:1920374-1920396 GGGGCTGGACTGGGGCAGGACGG + Intronic
1077501209 11:2910529-2910551 GTGGCTGGAGGGAGGAAGAAGGG + Intronic
1077570792 11:3337333-3337355 GTGTCTGGGCTCAGGCAGCAGGG + Intergenic
1079714690 11:23730777-23730799 GAAGCTGGAGAGAGGCAGCGAGG + Intergenic
1079926605 11:26501307-26501329 GAGGCAGGACACAGGAAGCAGGG - Intronic
1080402902 11:31953998-31954020 CAGCCAGGACAGAGGCAGCAAGG + Intronic
1081741929 11:45447008-45447030 GTGGCTGCAGAGGGGCAGGAGGG + Intergenic
1081868314 11:46371784-46371806 CAGGCTGGGCAGAGGCTGCAGGG + Intronic
1083000868 11:59289441-59289463 TTTTCTGGACAGTGGCAGCATGG - Intergenic
1083036534 11:59642649-59642671 GTAGCTCGACAGAGTCATCAGGG - Intronic
1083254319 11:61486890-61486912 GTGGCCAGCCTGAGGCAGCAGGG - Intronic
1083280853 11:61626645-61626667 GAGGCTGGACACAGGCTGCAAGG - Intergenic
1083731734 11:64655970-64655992 CTGGCTGGACAGAGAGAGCAGGG + Intronic
1083890682 11:65594297-65594319 AGGGCTGCAAAGAGGCAGCATGG + Intronic
1084360313 11:68664816-68664838 CTGGCAGGACAGAAGCAGCCAGG + Intergenic
1084448486 11:69218207-69218229 GGGGCAGGTCAGAGGCAGTATGG + Intergenic
1084627968 11:70323426-70323448 GAGGCTGGACAGAGGTAGGAAGG + Intronic
1084687818 11:70707509-70707531 GTGGACAGACAGAGGCAGGAAGG + Intronic
1085038037 11:73311202-73311224 GCTGCTGGATGGAGGCAGCATGG - Exonic
1085184124 11:74560911-74560933 GTGGCTGGAAGGAGGCACAAAGG - Intronic
1085277757 11:75310899-75310921 GTGGTGGGACAGAGGCAGTGTGG - Intronic
1085369118 11:75981801-75981823 ATGGCAGCACAGAGGAAGCAGGG - Intronic
1085528180 11:77176028-77176050 GTGGCAGGGCAGCCGCAGCAGGG + Intronic
1085824301 11:79827276-79827298 TAGGCTGGATAGAGGGAGCATGG + Intergenic
1085894783 11:80625810-80625832 GAGGCTGGTCAGCAGCAGCATGG - Intergenic
1086397443 11:86431536-86431558 GTGGCGGGGCAGCGGCGGCAGGG - Intergenic
1086496827 11:87412600-87412622 ATGGCTGAACAGATGCAGCCAGG + Intergenic
1087252984 11:95924176-95924198 GCGGCCGGACACAGCCAGCACGG - Exonic
1087440510 11:98177597-98177619 GAGGATGGACAGACGCTGCATGG + Intergenic
1088893885 11:114063811-114063833 GTGGCTGGACAGAGCCTCCCTGG + Exonic
1089603706 11:119629570-119629592 ATGGGTGGACAGAGGCAGGGTGG + Intronic
1091150537 11:133324389-133324411 TGGGCTGAGCAGAGGCAGCATGG - Intronic
1091437157 12:481688-481710 GTGGCTGGGCCCAGGCAGCTGGG + Intronic
1091800487 12:3321652-3321674 GCTGCTGGTGAGAGGCAGCAGGG + Intergenic
1093504964 12:19854554-19854576 GTGGCTGGAGAGAAGCAGAAAGG - Intergenic
1095987669 12:48010465-48010487 GTGTCAGGGCAGAGCCAGCAGGG + Intergenic
1096579121 12:52573204-52573226 GTGGCTGGAAAGGTGCAGCTGGG - Intronic
1097188477 12:57208381-57208403 GGCCCTGGGCAGAGGCAGCATGG - Intronic
1098751185 12:74294238-74294260 GTGGCTGGACAGGGGCTCCTGGG + Intergenic
1098867578 12:75780430-75780452 CTGTCTGGAGGGAGGCAGCAGGG + Intergenic
1099032832 12:77549579-77549601 GTTCATGGACAGATGCAGCAGGG + Intergenic
1099101704 12:78449512-78449534 GTGGCTGAACAGAGTGAGCTAGG + Intergenic
1099379287 12:81935772-81935794 GTGGCTGGAAAGAGGCTGAGTGG + Intergenic
1100667294 12:96768785-96768807 GGAGCTGGACACAGGCAGGATGG + Intronic
1100783526 12:98054960-98054982 GTGACTGGAGAGAGGCAAGAAGG - Intergenic
1100877353 12:98975838-98975860 GTGGTTGGGCAGAGGGAGCAGGG + Intronic
1103329115 12:120141594-120141616 GTGGCTGGAGTGAGGAGGCAGGG - Intronic
1103459292 12:121090924-121090946 CTGGCTGGGCAGTGGCTGCAGGG + Intergenic
1103595265 12:122021552-122021574 GGGGCTGGGCAGGGGCAGCTGGG + Exonic
1104280495 12:127372231-127372253 GCGGCAGGACAGAGAGAGCAGGG - Intergenic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104486858 12:129158913-129158935 GTGGCAGGAGAGAGGAAGCAAGG + Intronic
1104648511 12:130514167-130514189 GTGCTTTGAGAGAGGCAGCAGGG - Intronic
1104940044 12:132390752-132390774 GAGGCTAGCCAGAGGCTGCAGGG - Intergenic
1105722936 13:23134763-23134785 GTGGGTGGACAGGGGGAGCTGGG - Intergenic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1106403957 13:29457288-29457310 TTGGCTGGAAAGAGGCATGAGGG - Intronic
1109538423 13:63742864-63742886 GTGGGTTAACAAAGGCAGCAAGG + Intergenic
1109545415 13:63836908-63836930 GTGGGTTAACAAAGGCAGCAAGG - Intergenic
1109901607 13:68780208-68780230 GAGGGTGGACAGTGGGAGCAGGG + Intergenic
1112018910 13:95354537-95354559 CTGGGTGGACAGAGCCATCACGG + Intergenic
1112503314 13:99958146-99958168 TTGGCTGGGCAGAGGGGGCAGGG - Intergenic
1113179633 13:107610816-107610838 GAGGATGGACAGAGTCAACACGG + Intronic
1113439565 13:110317525-110317547 GAGGCTGGACAGAGGCGGGAGGG + Intronic
1113576627 13:111399659-111399681 GTGCCTGCACAGAGGAAGCAGGG - Intergenic
1113635032 13:111913532-111913554 GTGGCGGAAGAGAGGCAGCATGG - Intergenic
1113662511 13:112117186-112117208 GTGGCTGGAAAGGGACAGGAAGG + Intergenic
1113880408 13:113622367-113622389 GCGGCCACACAGAGGCAGCAAGG - Intronic
1113891777 13:113739779-113739801 GAGGCTGGCCACAGGAAGCAGGG - Intergenic
1115909610 14:38240902-38240924 ATGGCTGGAGAGAGGGAGAATGG + Intergenic
1115928100 14:38460138-38460160 GTGGCTGAGCAGAGAGAGCAAGG + Intergenic
1116982374 14:51185229-51185251 GTGGCAGGAGAGAGAGAGCAAGG + Intergenic
1117189899 14:53279183-53279205 GTGCCTGTACAGTGTCAGCAGGG + Intergenic
1118438702 14:65793524-65793546 GTGGCTGAAGAGGGGCAACAGGG + Intergenic
1119109949 14:71962285-71962307 GTGGCTGGGCAGAGGGAGGCCGG + Intronic
1119534504 14:75392034-75392056 CAGTCTGGACAGAGGCAGCCTGG + Intergenic
1119545673 14:75469745-75469767 GAGGCAGGACAGAGGCACCGAGG + Exonic
1120492659 14:85196215-85196237 GTGGATGGACGGAGGCTGCCAGG + Intergenic
1121012941 14:90532756-90532778 GTGGCTGAACACAGGCAGGAAGG + Exonic
1121089435 14:91170952-91170974 GTTGCTGATCAGAGGCAGCTGGG - Intronic
1121893518 14:97622194-97622216 GAGGCTGGTCAGTGGCAGCTGGG - Intergenic
1122024543 14:98866163-98866185 GTGGCTACAGAGCGGCAGCAGGG + Intergenic
1122147452 14:99700130-99700152 CTGCCTGGCCAGAGGCAGTAGGG + Intronic
1122889463 14:104725684-104725706 GTGGCGGGGCAGAGGCAGTGTGG - Intronic
1122920879 14:104879644-104879666 GGGGGTGGCCAGAGGCAGGAAGG + Intronic
1123189004 14:106550072-106550094 ATGGCAGGAGAGAGACAGCAAGG - Intergenic
1123706616 15:22955452-22955474 GGGGCAGGACAGAGGCAGCATGG + Intronic
1125031076 15:35076843-35076865 GTGGCTTGACAGAGGGAACTTGG + Intergenic
1126056703 15:44736542-44736564 GGAGCTGGAGAGAAGCAGCAAGG - Exonic
1126694815 15:51317000-51317022 GTGGCAAGACAGAGGGAGCATGG + Intronic
1126979547 15:54226806-54226828 GTGTCTGGACAGAGGGATCATGG + Intronic
1127277327 15:57458744-57458766 GGGGCTGGGCAGCGGCAGCAGGG + Intronic
1129192150 15:73943461-73943483 GTGACTAGGCAGAGGCAGCCTGG - Intronic
1130349543 15:83078951-83078973 GTGGCTGGGCACAGACAGCTGGG - Intergenic
1130368620 15:83263761-83263783 GTGGCTGGACTGCGGTAGAAAGG + Exonic
1130615941 15:85407845-85407867 GTGGCTTGGCAGAGGGAGAAGGG + Intronic
1130914796 15:88296598-88296620 GTGGGTGGTCCAAGGCAGCAGGG + Intergenic
1131121766 15:89827508-89827530 GTGGCTGGAAGGAGGGAGCCAGG + Intergenic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1132212705 15:100036206-100036228 GAGGGTGCAGAGAGGCAGCAAGG + Intronic
1132710260 16:1263211-1263233 CTGGCTGGAAAGAGCCAGGAGGG + Intergenic
1132864137 16:2085346-2085368 GTGCCTGGACAGGGCCAGCTGGG + Intronic
1133026619 16:2991444-2991466 GTGGCTGGGCAGGGGCCGCAGGG + Intergenic
1133281798 16:4670928-4670950 GTGGCAGGACAGAATCAGCTTGG + Intronic
1134187100 16:12092980-12093002 AGGGCTGGAAAGAGGCAGAATGG + Intronic
1134911747 16:18033363-18033385 GGGGCTGGAGAGAGGGAGAATGG - Intergenic
1135762607 16:25149100-25149122 TGGGCTGGCCAGAGGCAACAAGG + Intronic
1135882963 16:26277267-26277289 GCTCTTGGACAGAGGCAGCAGGG - Intergenic
1136521631 16:30800357-30800379 GGGGCTGGGCAGAAGCAGGAGGG + Intergenic
1137584849 16:49658281-49658303 GTGCCTGGCCAGAGGCAGGCAGG + Intronic
1138194090 16:55039967-55039989 ATGGCTGGACAGAGGCAAGAGGG - Intergenic
1138293711 16:55869259-55869281 GTGGGTGGACCGAGACAGCATGG - Intronic
1138483120 16:57317241-57317263 CTGGCTGGGCAAAGGCTGCATGG + Intergenic
1138694996 16:58804769-58804791 ATTGCTGGAGAGAGGCAACAGGG - Intergenic
1139531941 16:67546698-67546720 GTGGCTGGGCAGCGGCAGGGTGG - Exonic
1140028246 16:71311576-71311598 GCGGCTGAGCAGAGGGAGCAAGG + Intergenic
1140092492 16:71849891-71849913 GTGGCTGGGCAGAGCCAGGCAGG + Exonic
1140663561 16:77210032-77210054 GTGGCTGGACAGAGAAAGAAAGG - Intronic
1141435380 16:83996994-83997016 ATGGCTTGGGAGAGGCAGCAAGG - Intronic
1141557109 16:84843483-84843505 CTGGCTGGACGGAGGCAGGCTGG - Intronic
1141663347 16:85453409-85453431 GTGGCTGGACGTAGGAAGCAAGG + Intergenic
1141820550 16:86442537-86442559 GTGCCAGGAGGGAGGCAGCATGG - Intergenic
1141995416 16:87634086-87634108 GTGGGTGCAGAGAGGCAGGAGGG + Intronic
1142225525 16:88875429-88875451 GTGGCTGGGCAGGAGCACCAGGG + Exonic
1142252609 16:88999633-88999655 GGGGCGGGACAGAGGGAGGAGGG + Intergenic
1142505870 17:362879-362901 GTGGCTGGACAGCTACAGGAAGG - Intronic
1142683980 17:1566682-1566704 GAGGACGGACAGAGGGAGCAAGG - Intergenic
1143013299 17:3878278-3878300 GTGGATGAACAGAGGCACGAGGG - Intronic
1143991162 17:10963443-10963465 GGGGCTGGAGAGAAGGAGCATGG + Intergenic
1144773533 17:17772404-17772426 GTGGCTGCAGTGAGGCAGGATGG - Intronic
1144947843 17:18978888-18978910 GGGGCTGGGCGGAGGAAGCAGGG - Intronic
1145262283 17:21361511-21361533 GTGGCTGAACAGAGGGAGCGGGG - Intergenic
1146287005 17:31580987-31581009 TTGCCTGGACAGAGGCATCTAGG + Intergenic
1146301054 17:31690048-31690070 GTAGCTGGACTTAGGAAGCATGG + Intergenic
1147448052 17:40487089-40487111 GTGGCTGGACAGGGGTTGCTGGG + Exonic
1147454938 17:40531277-40531299 GTGGCAGGATGGAGGCAACATGG - Intergenic
1147553298 17:41460339-41460361 GAGGCTGGGCAGAGAAAGCACGG - Intronic
1147609251 17:41792060-41792082 GTGGGGAGATAGAGGCAGCATGG + Intergenic
1148338137 17:46855204-46855226 GTGGCTGCAGAGAGGCCGAAGGG + Intronic
1149186301 17:54001710-54001732 GTGGCTGGAGGGAGGCTACATGG - Intergenic
1149666395 17:58367695-58367717 GTGACTGGACAGAGGGTGGAGGG + Intronic
1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG + Intronic
1150606065 17:66692027-66692049 GAGGCTGGTCAGAGGCCGCAGGG + Intronic
1151184303 17:72352026-72352048 AGGGCCTGACAGAGGCAGCAGGG - Intergenic
1151352700 17:73541169-73541191 CTGGCTGGGGAGAGGCAGCTGGG + Intronic
1151353782 17:73546554-73546576 CTGGCTGACCAGAGGGAGCAAGG + Intronic
1151628849 17:75296141-75296163 GTGGAGGTGCAGAGGCAGCAAGG - Intergenic
1151658472 17:75506687-75506709 GTGGCTGTTCAGAAGCAGCTGGG + Exonic
1151700904 17:75742148-75742170 ATGGCTGGGCTGAGGCTGCAGGG + Intronic
1151994195 17:77598232-77598254 GTGGCTGCCCAGTGGCAGGATGG + Intergenic
1152002640 17:77656004-77656026 CAGGCTGGACAGAGGCTGCAGGG + Intergenic
1152441505 17:80312728-80312750 TTGGCAGGACAGAGGCTGCCTGG + Intronic
1152661324 17:81543649-81543671 CTGGCTGGGCAGAGGCTGCCTGG - Intronic
1152719408 17:81915560-81915582 TAGGCTGGGCAGCGGCAGCACGG - Intronic
1153613076 18:6907679-6907701 GTGGCTATAAAGAGGCAACAGGG + Intronic
1154144681 18:11857311-11857333 GTGGCTTCCCAGAGCCAGCAGGG + Intronic
1156942326 18:42783577-42783599 GAGGCTGGACAGAGGACACAAGG + Intronic
1157500874 18:48189829-48189851 ATGGCTGGAAAGGGGCAGGAGGG + Intronic
1159004808 18:63002432-63002454 GTGGCTGGGCAGAGACTGGAAGG + Intergenic
1160162106 18:76481141-76481163 GAGCCTGGTCAGAGGCAGGACGG + Intronic
1160217610 18:76946541-76946563 GTGGCTGACCACAGGAAGCATGG - Intronic
1160360302 18:78269522-78269544 GTGGCTCAACAGAAGCAGAATGG - Intergenic
1160533420 18:79578277-79578299 GTGTCTGGACAGAGGGAACCAGG - Intergenic
1160711738 19:555002-555024 GTGAGTGGACAGAGGCAACGTGG - Intergenic
1161124956 19:2550690-2550712 GGGGCTGGCCAGAGGCAGAGCGG - Intronic
1161467951 19:4442606-4442628 AAGGCTGCACTGAGGCAGCAAGG + Intronic
1161627261 19:5334552-5334574 GATGCTGGACTGAGGCTGCATGG - Intronic
1162128812 19:8513145-8513167 GGGGCTGGAGGGATGCAGCAGGG - Exonic
1162573375 19:11485148-11485170 ATCGCTGGACACAGGCACCATGG + Intronic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1162828155 19:13267035-13267057 GCGACAGGACAGCGGCAGCAAGG + Intronic
1163011711 19:14430778-14430800 GTGGCTGGAAGGAGTGAGCAAGG + Intergenic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163786338 19:19276855-19276877 CTGGCTGGACTGAGGAAGGAAGG + Intronic
1163816022 19:19465060-19465082 GTTGGGGGCCAGAGGCAGCAGGG - Intronic
1164850940 19:31483620-31483642 GAGGCTGCACAGGAGCAGCAGGG + Intergenic
1165138656 19:33686324-33686346 GTGGCTGGAGCCAGGCATCATGG + Intronic
1165331783 19:35144311-35144333 GTGGCTGGATGGGGGCAGTAGGG - Intronic
1165414534 19:35684188-35684210 GCGGCAGGACAGAGGCAGTGAGG + Intergenic
1165711967 19:38018001-38018023 GTGGCTGGATGGCTGCAGCAAGG - Intronic
1165741198 19:38206287-38206309 GTGGAGGGAGAGAGGCAGCAGGG - Exonic
1166546660 19:43638459-43638481 GTGGCTAGGCAGAAGCAGGAGGG - Intronic
1166590352 19:43992305-43992327 TTGGCAGGACAGAAACAGCAGGG - Intronic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1167049708 19:47070927-47070949 GTCCCTGGGCAGAGGCAGCAGGG - Intronic
1167776977 19:51564849-51564871 GGGGCTGGGCAGAGGCGGGAGGG - Intergenic
1168310802 19:55459640-55459662 GTGGCTGGGCTGAGGCTGGAGGG - Intronic
1168338262 19:55608964-55608986 GTGGTTGAAGAAAGGCAGCAAGG - Intronic
925060123 2:884616-884638 GTGGCTTGCCAGGGGAAGCAGGG + Intergenic
925753644 2:7111780-7111802 GTGGCAGGAGAGAGAGAGCAGGG - Intergenic
925871957 2:8279235-8279257 GAAGCTTGGCAGAGGCAGCAGGG - Intergenic
926143482 2:10382842-10382864 GTGGCTGGGCAGAAACAGGAAGG - Intronic
928314502 2:30235191-30235213 GGGGCAGTAGAGAGGCAGCAGGG - Intronic
929180319 2:39030999-39031021 GAAGCTAGGCAGAGGCAGCAGGG + Intronic
929916237 2:46138370-46138392 ATGGCTGGTAAGAGGCAGCGTGG - Intronic
930165182 2:48197397-48197419 GAGGCTGCACACAGGCACCAAGG + Intergenic
932799848 2:74731445-74731467 GTGGCTGGACCGAGGGAGAGAGG + Intergenic
933727204 2:85433720-85433742 GGGGGTGGTGAGAGGCAGCAAGG - Intronic
933831919 2:86218174-86218196 ATGGCTGGGCAGTGGCAGGAGGG - Intronic
934699054 2:96423908-96423930 GGGGGTGGACAGAGGCAGGAGGG - Intergenic
936283139 2:111160124-111160146 GAAGCTGGGCAGAGGCAGCAAGG - Intronic
938115532 2:128600796-128600818 GTGGCTCGGCAGAGGCAGAAAGG - Intergenic
938125727 2:128669954-128669976 GTGGCTGCAGGGAGGCAGCCGGG + Intergenic
938266128 2:129929573-129929595 GCCTCTGGACAGAGCCAGCAGGG - Intergenic
938573364 2:132582713-132582735 TTGGCTGGGCAGAGGCAGGCAGG - Intronic
939167080 2:138651757-138651779 GTGTGAGGACAGAGGCAGGAAGG + Intergenic
939350628 2:141033222-141033244 GTGGCTAGGCAGAGAGAGCAAGG + Intronic
941779389 2:169427527-169427549 GTGCCTGAACAGAAGCATCAGGG + Intergenic
942209244 2:173654226-173654248 GTGGCAGGAGAGAGACGGCAGGG - Intergenic
943670582 2:190656025-190656047 GTTGCTGTACATTGGCAGCAAGG + Exonic
944015153 2:195026952-195026974 GTGGATGGATTGAGGCAGGAAGG + Intergenic
946287030 2:218711334-218711356 GCGGCAGGACAGAGGAAGCTCGG - Intronic
946548663 2:220776134-220776156 GTGGCTGGACAAAGCCAGAGAGG - Intergenic
947212901 2:227724335-227724357 GAGGCAGGACAGAAGCAGAAAGG + Intergenic
948290305 2:236819464-236819486 GTGTCTGCACTCAGGCAGCATGG + Intergenic
948603341 2:239119855-239119877 GCGACTGCACAGAGGCAGCAGGG + Intronic
948612740 2:239180139-239180161 CTGGCTGTGCAGGGGCAGCAAGG - Intronic
948630359 2:239298561-239298583 GTGGGTGGAATGAGGCTGCAGGG - Intronic
949005929 2:241647769-241647791 GTGGCTTTAGAGAGGTAGCAGGG + Intronic
949081629 2:242105289-242105311 GTCCCTTGACAGATGCAGCAAGG + Intergenic
1169707592 20:8523168-8523190 GTGGATGAATAAAGGCAGCAGGG - Intronic
1169758087 20:9064650-9064672 GTGGGGTCACAGAGGCAGCAGGG - Intergenic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1171306800 20:24113549-24113571 GGAGCTGGACAGCAGCAGCAGGG + Intergenic
1171413991 20:24965278-24965300 GTGACTGGGGAGAGGCGGCAGGG - Intronic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1173413628 20:42837268-42837290 GTGGGTTGTCTGAGGCAGCAAGG - Intronic
1173524456 20:43721393-43721415 GTGGGTGGCCATGGGCAGCAGGG + Intergenic
1174065243 20:47860023-47860045 GTGGCTGCAGAGAGGCAGGATGG - Intergenic
1174507995 20:51029261-51029283 GTGGCTGGGCTGAAGCACCAAGG - Intergenic
1175525632 20:59631517-59631539 GGGCCTTGACAGAGGCAGGAGGG + Intronic
1175705095 20:61170952-61170974 CTGGATGGGCAGAGGCAGCTGGG - Intergenic
1175726330 20:61320986-61321008 GCAGCTGGACAGAGCCAGCCTGG - Intronic
1175743175 20:61435208-61435230 AAGGATGGACAGAGACAGCATGG - Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175939256 20:62530423-62530445 GGGCCTGGGCAGGGGCAGCAAGG - Intergenic
1176021587 20:62965035-62965057 ATGGCTGCAGAGGGGCAGCAGGG - Intronic
1176286650 21:5022341-5022363 GAGGCGGGACAGAGGCAGGTCGG - Intergenic
1176960049 21:15149265-15149287 GTTGGGGGACAGAGGCAGAAGGG - Intergenic
1178155354 21:29847229-29847251 ATGGCAGGAGAGAGGCAGGAAGG - Intronic
1178218281 21:30625601-30625623 AAGGCTGCACAGGGGCAGCAGGG + Intergenic
1178254993 21:31044227-31044249 GTGGCAGGACAGAGACTGAAGGG - Intergenic
1178895488 21:36553877-36553899 GTGGCTAAACAGAGTCAACATGG - Intronic
1178974150 21:37207681-37207703 GGGCCTGGCCAGAGGCAGGAAGG - Intergenic
1179786495 21:43733358-43733380 TTGGCTGTTCAGATGCAGCAGGG + Intronic
1179870531 21:44241134-44241156 GAGGCGGGACAGAGGCAGGTCGG + Intergenic
1179881849 21:44296313-44296335 GTGGGGGTACAGAGGCCGCAGGG - Intronic
1179915623 21:44476277-44476299 GTGGCAGGAGAGAGAGAGCAAGG - Intergenic
1180261092 21:46669470-46669492 GACGCTGGAGAGCGGCAGCAGGG - Intergenic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1181019908 22:20094294-20094316 GTGGGTGGAGAGATGCAGCCAGG - Intronic
1181312827 22:21954635-21954657 GTGTCTGGGCAGAGAAAGCAGGG + Intergenic
1181345934 22:22220707-22220729 GTGTCTGGGCAGAGAAAGCAGGG + Intergenic
1182624185 22:31634050-31634072 GTGGCTTGACTGAGGCAGGGAGG - Intronic
1183359515 22:37376162-37376184 GTGGGTGGCAAGAGGCAGGAGGG + Intronic
1183451060 22:37895332-37895354 GTGGCTGGATAGGGGCAGGGTGG - Intergenic
1183583004 22:38736719-38736741 GTGGCTAGACAGAGGCCCGATGG - Intronic
1183741296 22:39670030-39670052 GTGGTTGGTCACAGGCTGCAGGG - Exonic
1184175077 22:42784473-42784495 ATGGCTGCAGAGAAGCAGCATGG - Intergenic
1184258520 22:43301255-43301277 GAGGATGGACAGAGGCAGGATGG - Intronic
1184385507 22:44172142-44172164 TGGCCTGGACAGATGCAGCAAGG + Intronic
1184549996 22:45199424-45199446 GAGGCTGCACAGAGCCAGGAGGG + Intronic
1184657513 22:45949242-45949264 GGGGCTGTGCACAGGCAGCAGGG + Intronic
1184841892 22:47056989-47057011 GTGGCTGGGCCTAGGCAGCAAGG - Intronic
1184853199 22:47132519-47132541 GTTGCAGGCCAGAGACAGCAGGG - Intronic
1185376397 22:50484446-50484468 GTGGCTGCTGAGAGGCTGCAGGG + Exonic
950031489 3:9856817-9856839 ATGGCAGGACAGAGGAAGCAGGG - Intergenic
950032170 3:9860475-9860497 GTGGCAGGGCAGAGGAAGCAGGG - Intergenic
950415316 3:12865997-12866019 GTGGCAGGGCAGAGGAAGCAAGG - Intronic
950416951 3:12874287-12874309 GTGGCAGGGCAGAGGAAGCAGGG - Intergenic
950482783 3:13254898-13254920 GTGGATGCACAGAGACCGCATGG - Intergenic
950569339 3:13790560-13790582 GTGGCTCTACAGAGCCAGCTGGG + Intergenic
952535063 3:34300560-34300582 GAGGAAGGACAGAGGCATCAGGG + Intergenic
952551071 3:34477497-34477519 GTTCCTGGACAGAGGCAGTGAGG - Intergenic
952582861 3:34855045-34855067 GTCCCAGGACACAGGCAGCAGGG + Intergenic
953154514 3:40356976-40356998 GTTGGTGGAGGGAGGCAGCAGGG - Intergenic
953752311 3:45618162-45618184 GTGGTTGGAGGGAGGCAGGAGGG + Intronic
954635927 3:52070864-52070886 GTGGCAGGAGAGAGCCGGCAGGG + Intergenic
954939715 3:54360502-54360524 GTGGCAGGACTCAGGCTGCAGGG + Intronic
957051872 3:75417770-75417792 GTGGCAGGGCAGGGGCAGCTTGG + Intergenic
957665082 3:83217238-83217260 GTGTCTGGACAAGGGGAGCACGG + Intergenic
958922058 3:100118563-100118585 GTGCTTGAACAGAGGCCGCATGG - Intronic
959211115 3:103382219-103382241 GTGGATGGACAGAGGCCATAAGG - Intergenic
959595687 3:108126184-108126206 GTGACTGGATAGAGGGAGCATGG + Intergenic
960855511 3:122098431-122098453 GTGGCTGGGGAGAGTAAGCAGGG + Intronic
961367910 3:126413114-126413136 GTTGCTAGACAGAAGCAGAAGGG + Intronic
961429105 3:126867786-126867808 GAGGGAGGACAGAGACAGCATGG - Intronic
961714203 3:128847590-128847612 GGGGCAGGGCAGAGGAAGCAGGG + Intergenic
961783637 3:129336453-129336475 GCGGCAGCACAGAGGAAGCAGGG - Intergenic
962751019 3:138434866-138434888 CTGGCTGGACAGGCGCAGCTCGG - Exonic
963757482 3:149250738-149250760 GTGTCTGGAGGGAGGGAGCAAGG + Intergenic
966321439 3:178705340-178705362 GCTGCTGCACAGTGGCAGCATGG - Intronic
966761888 3:183426385-183426407 GTGGCGTGACAGAGGGACCAGGG + Intronic
967220494 3:187244156-187244178 CTGCCTGTAGAGAGGCAGCAGGG - Intronic
967348822 3:188489355-188489377 GTGACTGGAGAGAGGCAAGAAGG + Intronic
968881986 4:3305681-3305703 GTGGCAGTTCAGAGGCAGGAAGG + Intronic
969388349 4:6871988-6872010 TTGCCTGCACAGAGGCAGGAGGG + Intronic
969514785 4:7641015-7641037 AGGGTTGGAAAGAGGCAGCATGG + Intronic
969605844 4:8201886-8201908 GTGGATGGAGAGAGGCTGCTGGG + Intronic
969610109 4:8223028-8223050 GTGGATGGACGAGGGCAGCAGGG - Intronic
969967088 4:11008068-11008090 GAGGCTGGACAGAGGGAGTGAGG + Intergenic
970372786 4:15424701-15424723 GTGGTTGAAGAGAGGCATCAAGG - Intronic
970454251 4:16206468-16206490 GAGGCTGGAATGATGCAGCAAGG + Intronic
970848725 4:20575605-20575627 GTGCCTGGAAGGAGGCAGCAAGG - Intronic
971148296 4:24003663-24003685 GTGGCTGCAAAGAGCCGGCAGGG + Intergenic
973710852 4:53629256-53629278 GTGGCTGGAGACAGGGAGGAGGG - Intronic
973899920 4:55458384-55458406 CTGACTGGAAAGAGGCAGCCAGG - Intronic
973926397 4:55742946-55742968 GTGCCTGTACAGTGTCAGCAGGG - Intergenic
975508208 4:75162784-75162806 GTGGTAGGACAGAGTCATCAAGG + Intergenic
976503652 4:85820484-85820506 GAGGCTGGAAGGAGGGAGCAGGG + Intronic
976708493 4:88043377-88043399 CTGGCTGGACCGAGGAACCAGGG + Exonic
977893600 4:102340256-102340278 GAGGGTAGAGAGAGGCAGCAGGG + Intronic
981632679 4:146838976-146838998 CTGGCTGGACAGAGGGGTCAGGG - Intronic
982772324 4:159408208-159408230 GTGGCAGGACAGAGTGAACAAGG - Intergenic
984189001 4:176582278-176582300 GTGACTGGATAGAGGGGGCAGGG + Intergenic
985192386 4:187389912-187389934 GCGGCTGCAGAGAGGCAGAAAGG + Intergenic
985540720 5:486227-486249 GAGGATGGGCAGGGGCAGCACGG + Intronic
985543610 5:498382-498404 GTGGCTGGACTGATGCTGGAAGG - Intronic
985666412 5:1183664-1183686 AGGGCTGGGCAGAGGCAGGAAGG + Intergenic
985787864 5:1909190-1909212 GTGCCTGGACAGGGGGAGGAAGG - Intergenic
986210164 5:5664568-5664590 CTGCCGGGACAGAGGCAGCCTGG - Intergenic
986433537 5:7705376-7705398 GTTACAGGACAGAGGCAGCAAGG + Intronic
987088214 5:14488292-14488314 CTGGCGGGACAGAGGCAGGGGGG - Intronic
991564010 5:67985777-67985799 TTGGCTGGAATGAGGCAGGATGG - Intergenic
992225569 5:74616880-74616902 GTGCCTGTACAGTGTCAGCAGGG + Intergenic
992859737 5:80898216-80898238 GTGCCTGGACAGGGGCAGTGAGG + Intergenic
993050739 5:82923198-82923220 CTGGCTGTAAGGAGGCAGCAGGG - Intergenic
993432295 5:87846768-87846790 GTGGCTGAACAAAGACAGCAGGG - Intergenic
995402374 5:111757519-111757541 GCGGCTGCACAGTGGCAGCAAGG - Intronic
995743851 5:115383151-115383173 ATGGCAGGCCAGAGGCAGGAAGG + Intergenic
996685087 5:126270905-126270927 GGGGCTGGACAGTGGGAGAAAGG + Intergenic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
997838750 5:137218861-137218883 GTACCTGGGCAGAGGCGGCATGG + Intronic
998078176 5:139253256-139253278 GTGGCTTGCCAGAGACAGCAAGG - Intronic
998104495 5:139459766-139459788 CTGGGTGGACAGAGGCGGCTGGG + Intronic
998230966 5:140361174-140361196 GTGTCTGGGCAGAGGGAGAAGGG + Intronic
998466891 5:142353793-142353815 ATGGCTGGGCAGAGGCATGAGGG - Intergenic
998923402 5:147095972-147095994 GTGGCTGCAAAGAGGCAGGAGGG + Intergenic
999185304 5:149703086-149703108 GGTGCTGGAGAGAGGCAGCCTGG - Intergenic
999198350 5:149798542-149798564 CTGGCTGCTCACAGGCAGCACGG - Intronic
999248996 5:150170621-150170643 GTGGAGAGACAGAGGCAGCCAGG - Intronic
999498353 5:152122609-152122631 GAGGCAGGAGACAGGCAGCATGG - Intergenic
999527900 5:152428040-152428062 GTGGCAAGACAGAGGAAGTATGG + Intronic
999802099 5:155047906-155047928 GTGGCAGGAGAGAGAGAGCAGGG + Intergenic
999866238 5:155703294-155703316 GTGGCAGGACATAGAAAGCATGG - Intergenic
1000327711 5:160184848-160184870 GTGGCTGGACACAGGAATCTGGG + Intergenic
1000356295 5:160399530-160399552 GTGGCTGGGCAGACGCTCCAGGG + Intronic
1000428652 5:161123461-161123483 TTGACTGGACAGAGGCAAAAGGG + Intergenic
1001571673 5:172734164-172734186 CTGGCTGGGCAGAGACAGCAAGG - Intergenic
1001901721 5:175436529-175436551 GTGGACAGACAGAGGCAACAGGG + Intergenic
1002194457 5:177494678-177494700 GTGGCTGGAGAGAGGCAGGGAGG + Intronic
1002424666 5:179168008-179168030 GAGGCTGGTCTGAGGCAGGAGGG - Intronic
1002443242 5:179275044-179275066 GTGGGTGGACAGGAGCATCAAGG + Intronic
1002565876 5:180112907-180112929 GTGGATGGACAGAGGGATCCGGG + Intronic
1002633052 5:180593725-180593747 GTGGCTGCTCAGAGGTAGAATGG + Intergenic
1003002454 6:2348922-2348944 GAGGTTGAACAAAGGCAGCAGGG - Intergenic
1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG + Intronic
1006272552 6:32975157-32975179 GTGGTTAGAGAAAGGCAGCAGGG + Intronic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006620280 6:35359163-35359185 GTGGCTGGACAGAGGGAGGGAGG + Intronic
1006919913 6:37620613-37620635 GTGGCTTGACTGGGGCAGGATGG + Intergenic
1007282088 6:40720336-40720358 GTGCCTGGATAGAGAAAGCAGGG + Intergenic
1007844314 6:44741043-44741065 GTGGCTGGACCGAGACCGCCAGG - Intergenic
1007928082 6:45665994-45666016 GGTGGTGGAGAGAGGCAGCAGGG + Intergenic
1007955074 6:45910815-45910837 GTTACTGGAGAGAGCCAGCAAGG + Intronic
1008132069 6:47729894-47729916 AGGGCTGGACAGCAGCAGCAGGG - Intergenic
1008579229 6:52890684-52890706 ATGGCTGGAGAGAGGCAGTGGGG - Intronic
1008869671 6:56258333-56258355 GTAGCTGGGCAGAGGCTGAAGGG - Intronic
1011547686 6:88499222-88499244 GGGTCTGGGCAGAGGGAGCAGGG + Intergenic
1013170494 6:107633927-107633949 GTGGCTGGACGGAGACAGGAGGG - Exonic
1013662254 6:112309486-112309508 GTGGCTTGCCAAATGCAGCAGGG - Intergenic
1018288418 6:162265293-162265315 GTGGCTGGACACAGATTGCAGGG - Intronic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1019129175 6:169860810-169860832 GTGGCAGGAGAGAGACAGCAGGG - Intergenic
1019570509 7:1709436-1709458 GGGAGTGGACAGAGGCCGCAGGG + Intronic
1019625244 7:2012599-2012621 GAGGATGGACAGAGGGGGCAGGG + Intronic
1019925978 7:4191988-4192010 GTGGCTGGAGAGGAGGAGCAGGG - Intronic
1021967711 7:25937914-25937936 GAGGGTGGACAGTGGCAGAAAGG + Intergenic
1022500062 7:30877141-30877163 GTGGCTGGTGAGAAGCACCAGGG + Intronic
1023268998 7:38439097-38439119 GTGGCAGGAGAGAGACAGCAGGG - Intronic
1023296559 7:38721145-38721167 GGGGCTTGTCAGAAGCAGCAGGG + Intergenic
1023712437 7:43009280-43009302 GTGGGAGGACAGAAGCATCATGG + Intergenic
1024207229 7:47174219-47174241 TTGGGTGCACAGAGACAGCATGG - Intergenic
1024700404 7:51899819-51899841 GCAGCTGGGCTGAGGCAGCAGGG + Intergenic
1024747364 7:52423752-52423774 GTTTCTGGACAGAGTCATCAAGG + Intergenic
1026469707 7:70684691-70684713 GGGGATGGACAGTGGGAGCATGG + Intronic
1026931039 7:74223123-74223145 GTGGCTGGAGAGAGGGAGGGAGG - Intronic
1027343898 7:77237952-77237974 ATGGCTGGGGAGTGGCAGCATGG - Intronic
1027820973 7:83044129-83044151 GTGGCAGGGGAGAGACAGCAAGG + Intronic
1028839952 7:95418465-95418487 GTGGCTTTACAGAGGAATCAGGG - Intronic
1029453476 7:100655631-100655653 GGGGCTGGACAGGGGCAAGAGGG - Intronic
1029698044 7:102227547-102227569 GTGTCCGGAGAGAGGCAGCGGGG - Exonic
1029935818 7:104423164-104423186 TAGGATGGGCAGAGGCAGCAGGG + Intronic
1030079790 7:105767391-105767413 ATGGCGGGAGAGAAGCAGCAAGG - Intronic
1032090045 7:128907045-128907067 GTAGCTGGAGAGAGGCAGACAGG + Intronic
1032241475 7:130162516-130162538 GGGCCTGGACAGCCGCAGCAGGG - Intergenic
1032684899 7:134223411-134223433 GCGGCTTCTCAGAGGCAGCAGGG + Intronic
1033341523 7:140495830-140495852 GTGGCTGGACCCAGGGAGCCAGG + Intergenic
1034787993 7:153942799-153942821 GTGGCAGGGAAGAGGCAGAATGG - Intronic
1035225373 7:157429640-157429662 ATGGCTGGGCAGAGGCACCATGG + Intergenic
1035539537 8:422079-422101 GTCCCTTGACAGATGCAGCAAGG + Intronic
1035583784 8:756725-756747 GTGGCTGGGCAGAGCCTGCGTGG - Intergenic
1035754383 8:2020884-2020906 GGGGCAGGGCAGAGCCAGCAGGG + Intergenic
1036206336 8:6808068-6808090 GTGGCTGCGCATGGGCAGCAAGG - Intergenic
1036555465 8:9855813-9855835 TTGCCTGGACACATGCAGCAGGG - Intergenic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1037891794 8:22627561-22627583 GTGGTTGGGTAGAGTCAGCAGGG - Intronic
1038441240 8:27572186-27572208 GAGGCTGGGCAGAGTGAGCATGG + Intergenic
1040565794 8:48565573-48565595 GTGGCCGCACAGATGCAGGAGGG + Intergenic
1040754789 8:50759892-50759914 GTAGCTGGACAGGGATAGCATGG + Intronic
1041884434 8:62792171-62792193 GTGGCTGCATAGATGCAGAAAGG - Intronic
1043779295 8:84312114-84312136 GTGGCAGGAGAGAGATAGCAAGG + Intronic
1047853604 8:128885613-128885635 TTTGTTAGACAGAGGCAGCAGGG - Intergenic
1048336085 8:133503512-133503534 GGGGCTGGACGGAGGGAGGAAGG - Intronic
1048580737 8:135728305-135728327 GTGCCTGGAGAGAGGCATCAGGG - Intergenic
1048923007 8:139247578-139247600 GTGTCTGTACAGAGGGAGAAAGG + Intergenic
1049153560 8:141052760-141052782 GCGTCTGCACAGAGGCAGAATGG - Intergenic
1049205977 8:141363781-141363803 GTGGCAGGACAGAGGCAGACAGG - Intronic
1049235988 8:141512570-141512592 GTGGCTGGACTGTTGCAGGAGGG + Intergenic
1049343715 8:142127427-142127449 GGGACTGGACAGATGCAGCCGGG + Intergenic
1049352333 8:142170911-142170933 GTGTCTGGACCCAGGCGGCATGG - Intergenic
1049499386 8:142953442-142953464 GAGCCTGGGCAGAGGCAGCAGGG - Intergenic
1049568816 8:143358731-143358753 GAGCCTGGACCCAGGCAGCAGGG + Intronic
1049595654 8:143482132-143482154 TAGGCTGGAGAGAGGCTGCATGG - Intronic
1049697864 8:143992388-143992410 GTGGCTGGGCTGTGGCCGCAGGG + Intronic
1050745801 9:8874558-8874580 TTGGCTGGCCAGAGGCACCAAGG - Intronic
1050795955 9:9541790-9541812 CTGGCTGAAGAGTGGCAGCAGGG + Intronic
1052934886 9:34084812-34084834 CTGGCTGGAAAGTGGGAGCAAGG + Intergenic
1056714784 9:89020307-89020329 GTGGAGGGTGAGAGGCAGCAGGG + Intronic
1056857155 9:90141493-90141515 AGGTCAGGACAGAGGCAGCAGGG + Intergenic
1057307402 9:93920369-93920391 GGGGCTGGCAAGAGGCGGCATGG - Intergenic
1057383694 9:94590079-94590101 GTGCCTGGAGAGAGGGTGCAGGG - Intronic
1057411239 9:94818035-94818057 GTGGCAGGTCTGAGGCACCATGG - Intronic
1057836808 9:98451855-98451877 GGGGCTGGCCAGAGGGAGCATGG - Intronic
1057851887 9:98572391-98572413 CTTGCTGGACAGAGACAGCCAGG - Intronic
1059023172 9:110598009-110598031 GTGGCAGGTGAGAGGGAGCATGG + Intergenic
1059191008 9:112326079-112326101 GGGTCTGGAAAGAGGCAACAGGG + Intronic
1059429846 9:114243457-114243479 GAAGCTGGACAGGGGCAACATGG - Intronic
1059492706 9:114682278-114682300 GTGGGCGGACAGAGACAGAATGG - Intergenic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1060058262 9:120434660-120434682 GGGGCTGCACAGAGGCAGCCAGG + Intronic
1060252476 9:121997385-121997407 GGGGCTGGACAGAGGCTGGCTGG - Intronic
1060756825 9:126219763-126219785 GTGGCTGGACACCGAGAGCAGGG - Intergenic
1060889063 9:127176847-127176869 GTGGATGGACAGAGCCACTAGGG - Intronic
1061000237 9:127898830-127898852 GTGGCTCGGCACAGGCACCAGGG + Intronic
1061194532 9:129100563-129100585 GTGGCAGGCCAGATGCTGCATGG - Exonic
1061377251 9:130233911-130233933 ATGCGGGGACAGAGGCAGCAGGG - Exonic
1061505467 9:131029404-131029426 GTGGCTGCACAGACGCAGGTGGG - Intronic
1061573326 9:131491071-131491093 CTTGCTGGACAAAGGCAGAAAGG + Intronic
1061577054 9:131513894-131513916 GGGCCTGTGCAGAGGCAGCAAGG - Intronic
1061792489 9:133066145-133066167 GTGGCAGGACACAGACAGGAGGG + Intronic
1061806690 9:133140943-133140965 GTGGCTGGGCAGAGTCCCCATGG + Intronic
1061877950 9:133554307-133554329 GGGGCTGGACAGAGTAAGGAGGG + Intronic
1062201196 9:135303700-135303722 GTGGTTAGAAAGAGGCTGCATGG - Intergenic
1062229988 9:135476727-135476749 GTGGATGGGCGGTGGCAGCAGGG - Intergenic
1062316125 9:135967696-135967718 GTGGCTGGCTTGAGGCACCACGG - Intergenic
1062540762 9:137040778-137040800 GGGGGTGGGCAGGGGCAGCAGGG - Intronic
1062697537 9:137883169-137883191 ATGGCTGGCCTGAGCCAGCATGG + Intronic
1189129689 X:38485377-38485399 GAGGGTGGGGAGAGGCAGCATGG + Intronic
1190328109 X:49219048-49219070 GTAGCTGGGTAGAGGCAGAAGGG - Intronic
1190909537 X:54758539-54758561 GTGGCAGGACAGGTGCAGCCAGG - Exonic
1191253960 X:58271873-58271895 GTGGATGGACACAGGCGGCCAGG - Intergenic
1195625913 X:107005759-107005781 ATTGCTGGGCAGTGGCAGCAGGG - Intergenic
1197171863 X:123443677-123443699 GTGTCTGTACAGAGGCTTCAGGG + Intronic
1199473882 X:148224750-148224772 GTGGATGGGCAGAAGCTGCATGG + Intergenic
1199706359 X:150428776-150428798 CTGGCTGGACCCAGGAAGCAGGG - Intronic
1199905392 X:152223549-152223571 GTGGCTGGCCAGAGTGAGGAAGG - Intronic
1200219356 X:154383563-154383585 GTGGCTGGACAGAGGCAGATGGG + Intergenic