ID: 1003576843

View in Genome Browser
Species Human (GRCh38)
Location 6:7304902-7304924
Sequence TCTTAAGTGCATGAGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003576843 Original CRISPR TCTTAAGTGCATGAGCTGGA TGG (reversed) Intronic
901523560 1:9804530-9804552 TCTTAAGTGGAGAAGCTGGGTGG - Intronic
901853920 1:12032064-12032086 CCTCAAGTGCATTAGCAGGATGG - Intergenic
905489084 1:38329500-38329522 GCTTCAGAGCAGGAGCTGGAGGG - Intergenic
908474789 1:64476881-64476903 GCTTAAGTGGATGAGCAGGCAGG + Intronic
913373924 1:118130620-118130642 TCATCAGTGGATGAACTGGAAGG - Intronic
916958598 1:169866014-169866036 TCTTAAGCTGATGAGCTAGAGGG - Intronic
920512894 1:206564012-206564034 TCTTAGTGGCTTGAGCTGGATGG - Intronic
1063047116 10:2403634-2403656 TCTCAAATGCATGAGCTCAAGGG - Intergenic
1063061768 10:2563136-2563158 TACTTAGTGCATGAGTTGGAGGG + Intergenic
1063583340 10:7329481-7329503 TGCAAAGAGCATGAGCTGGAGGG + Intronic
1064583458 10:16816931-16816953 TCTCCCGTGGATGAGCTGGAAGG - Intronic
1064720950 10:18227968-18227990 TCTTCAGTGCATGCTCTGAAAGG + Intronic
1064873619 10:19967960-19967982 TATTATGTGCATTAGCTGAAAGG + Intronic
1067278807 10:44855967-44855989 TATTAAGTAGATGAGTTGGATGG - Intergenic
1074002895 10:109390144-109390166 TCAGAAGTCCAGGAGCTGGAAGG - Intergenic
1074027103 10:109647675-109647697 CCTGAAGTACATTAGCTGGAGGG - Intergenic
1074368534 10:112879647-112879669 TCTTAAGACCATGAGCTTTAAGG + Intergenic
1075708213 10:124515651-124515673 TCTTAACAGCAAGATCTGGAAGG - Intronic
1077820732 11:5737404-5737426 TCTGAAGTGCATAAACTGTAGGG - Exonic
1078719493 11:13871411-13871433 TCCTAAGGGCATGAGGTGGAAGG + Intergenic
1085160441 11:74338385-74338407 TTTTAAGTGCGTGAGCTGTATGG + Intronic
1088777006 11:113095042-113095064 TCTTAACTGCAAGAACTCGAAGG - Intronic
1089322101 11:117633345-117633367 TCCCAACTGCAAGAGCTGGAGGG + Intronic
1089835416 11:121366080-121366102 TCTTAAGTGCTAGAACTGTAGGG + Intergenic
1095606710 12:44076528-44076550 TTTTAACTTCATGAGCTGGGAGG - Intronic
1098000326 12:65934897-65934919 TCTTAAGAGCAAGAGAAGGAAGG + Intronic
1100672223 12:96828460-96828482 TATTGACTGCATGAGCTGAAAGG - Intronic
1100720877 12:97356763-97356785 TCATCAGTCCCTGAGCTGGAGGG + Intergenic
1106567297 13:30897451-30897473 TCTTCACTGCATCAGCTGTATGG + Intergenic
1106657555 13:31762444-31762466 TTCTGAGTGCATGAGGTGGAGGG + Intronic
1108269952 13:48749724-48749746 TCTTAAGTGCTTCTGCTGGATGG - Intergenic
1109389707 13:61677551-61677573 AATTAAGTGCATTATCTGGAAGG + Intergenic
1112547354 13:100383725-100383747 TCTTAGATGCTTGAGGTGGAAGG + Intronic
1116809058 14:49521936-49521958 TCTTAAGTGGATCAGTTGCAAGG - Intergenic
1117825653 14:59700256-59700278 TCTTATGTTCATGAATTGGAAGG + Intronic
1118539673 14:66808421-66808443 TGTTAAGTGAATGATCTTGAAGG + Intronic
1119085853 14:71738269-71738291 TCTAAAGTGGACCAGCTGGAAGG + Exonic
1121660758 14:95633286-95633308 TCTGCATTGCATGTGCTGGAAGG + Intergenic
1121881307 14:97502860-97502882 TATAGAGTGCATGAGCTGCAGGG + Intergenic
1127261947 15:57332814-57332836 GACCAAGTGCATGAGCTGGAAGG + Intergenic
1128097912 15:64972439-64972461 TATTTAGTGCATTATCTGGACGG + Intronic
1143130617 17:4674808-4674830 CCTTAAGGGCATCAGCTGGCGGG + Exonic
1146699942 17:34948812-34948834 TCTCAAATTCCTGAGCTGGAGGG - Intronic
1146988854 17:37248643-37248665 TCAGAAGTGTATGAGCAGGAAGG + Exonic
1148625474 17:49066074-49066096 TCTTAAGTGTATGTGCTGCTGGG - Intergenic
1154331146 18:13429929-13429951 TATTGAGTGTAAGAGCTGGAAGG + Intronic
1155649184 18:28119828-28119850 TTTTAAACGCATGACCTGGAAGG - Intronic
1155783274 18:29866843-29866865 TTTTAAATGCATGAACTGTATGG + Intergenic
1159698371 18:71590613-71590635 TTTTAAGTGAATGAGATGTATGG + Intergenic
1162730213 19:12714137-12714159 TCTGAAGTTCCTAAGCTGGAAGG + Intronic
1164155457 19:22593890-22593912 GCTGAAGTGCATGATGTGGATGG + Intergenic
1164792378 19:30998360-30998382 TCTTAGGAGGATGAGGTGGAAGG + Intergenic
925413365 2:3653030-3653052 TCTCCAGTGCATCAGCTGGGAGG + Intergenic
926804082 2:16688507-16688529 TCTTAAGTGAAGGAGCTGGTAGG + Intergenic
927218063 2:20680993-20681015 TCTGCAGAGCCTGAGCTGGATGG + Intergenic
928531573 2:32197877-32197899 TTTTAAGGGCATCAGCAGGATGG + Intronic
929163619 2:38858492-38858514 ACTTAAGTGCATATGCTAGATGG - Intronic
929867233 2:45728595-45728617 TCTAGAGTGTCTGAGCTGGAAGG + Intronic
930070422 2:47361692-47361714 TCTTGAGTAAGTGAGCTGGAAGG - Intronic
933321376 2:80779575-80779597 TTTTAATTGCATGAGGTGGGGGG - Intergenic
933597540 2:84297269-84297291 TTTTCAGAGCATGAGGTGGAAGG - Intergenic
936165523 2:110116394-110116416 TCCCAGGGGCATGAGCTGGAAGG - Exonic
937575442 2:123415368-123415390 TTTTAAGTGCATGAGCTATCTGG - Intergenic
938662750 2:133504430-133504452 CCTTAAATGCATGTGCTGAATGG - Intronic
1170667344 20:18398198-18398220 ATTTAAGTGCACGATCTGGATGG + Intronic
1173201492 20:40958423-40958445 TCTAAAGGGGATGAGATGGATGG + Intergenic
1178936193 21:36864101-36864123 TCTAAAGTGCATGAACAGGCTGG + Intronic
1182701761 22:32245813-32245835 TCTGAAGAGCATGAGCAGGCCGG - Intronic
949561932 3:5211057-5211079 TCTTAAGTGAATCAGCAGGTGGG + Intronic
951777660 3:26326788-26326810 ACCTAAGAGCAAGAGCTGGAAGG - Intergenic
953365141 3:42337798-42337820 TCCTTAGTTCATGAGCTGAAAGG + Intergenic
954534849 3:51352012-51352034 TCTAAAATGCCTGGGCTGGATGG - Intronic
954929849 3:54272073-54272095 TCTTAAGTGCTGGGTCTGGATGG + Intronic
955849371 3:63203605-63203627 TCTTTAGTGAATGAATTGGAAGG - Intergenic
956896424 3:73665445-73665467 TCTGAAGATCATGAGCTGCATGG - Intergenic
957797063 3:85023095-85023117 TTTTAAGTGCATTATATGGAAGG + Intronic
958684454 3:97375130-97375152 TCTAAACTTCATGAGCTGGCAGG - Intronic
959539086 3:107520547-107520569 TCTGAAGTTCATGATTTGGAGGG + Intergenic
961975434 3:131019558-131019580 TCCTGAGTGCATGACCTGTAAGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
967959439 3:194908687-194908709 CCATAAGTGCCAGAGCTGGAGGG - Intergenic
973107503 4:46358590-46358612 TTTTAAGTGCATGCATTGGATGG + Intronic
973191353 4:47389343-47389365 TTCTAGGTGCATGAGCTGTAAGG + Intronic
977961576 4:103090989-103091011 CCTTGAGTGGATGAGCTGGAAGG + Intronic
979966334 4:127080433-127080455 TTATTAGTGCAAGAGCTGGAGGG - Intergenic
981507282 4:145516472-145516494 TAGTAAGTGCAGGAGCTGTATGG - Intronic
991385810 5:66087732-66087754 TCTTAAAGGCAAGACCTGGAAGG + Intergenic
994001872 5:94790702-94790724 TCTTAAGAGTATGAGTTGGTAGG + Intronic
994592274 5:101788430-101788452 GCTTAGGTGCATGAGCTGTGCGG + Intergenic
1001060153 5:168481430-168481452 TCTTAATTGAATGAGTAGGAAGG - Intergenic
1001126493 5:169024279-169024301 TGTTATGTGCATGACCTGGTAGG + Intronic
1003576843 6:7304902-7304924 TCTTAAGTGCATGAGCTGGATGG - Intronic
1010400953 6:75445145-75445167 TTTGAAGTGTATGAGTTGGAGGG - Intronic
1011326183 6:86151669-86151691 GCCTAAGTGCCTGAGCTGGGAGG + Intergenic
1011546671 6:88489166-88489188 TCTTAAGAGCAAGAGCCGAAAGG - Intergenic
1012246449 6:96931351-96931373 TCTTAAGCCCATGAGCCGGGGGG - Intronic
1018619475 6:165715991-165716013 ACTTTAGTGCAGGAGCCGGAGGG - Intronic
1021071547 7:16248228-16248250 ACTCAAGTGGCTGAGCTGGAGGG + Intronic
1022840589 7:34160616-34160638 TTCTAAGTGCATGGGCTGGCTGG + Intergenic
1024902175 7:54332464-54332486 TGTCAAATGAATGAGCTGGATGG - Intergenic
1025973272 7:66348539-66348561 TCTTCAGTGCTTGAGGTGGGAGG + Intronic
1026771737 7:73205987-73206009 CCTTAAGTCCATGAGCTGACAGG - Intergenic
1027012605 7:74759383-74759405 CCTTAAGTCCATGAGCTGACAGG - Intronic
1027075435 7:75186670-75186692 CCTTAAGTCCATGAGCTGACAGG + Intergenic
1030271034 7:107668386-107668408 TCTGCAGTAGATGAGCTGGAAGG + Intronic
1032670712 7:134079987-134080009 TATTAATAGCATAAGCTGGATGG - Intergenic
1037574232 8:20185720-20185742 ATTTAAGTGCATGAGCTTGAAGG + Intergenic
1040623746 8:49120078-49120100 TCTTAAAAGAATGAGGTGGAAGG - Intergenic
1040830785 8:51674948-51674970 TCTTAATTCGATGACCTGGAAGG + Intronic
1040859527 8:51984634-51984656 TCTTAAGTCCATGGGATGCATGG + Intergenic
1043478221 8:80625986-80626008 TCTTGATTGCATGCGTTGGAAGG + Intergenic
1044725466 8:95191085-95191107 TTTGAAGTGCTTGAGGTGGAGGG + Intergenic
1046382638 8:113471348-113471370 TCCTAGGGGCATGAGTTGGATGG + Intergenic
1047305933 8:123652975-123652997 TCTCAGCTGCATGTGCTGGAGGG + Intergenic
1047890231 8:129300723-129300745 TGTTAAGTCCATTAGCTGTAAGG + Intergenic
1052240041 9:26260859-26260881 TGTTAAGTGCATTAGGTGAAAGG - Intergenic
1055023322 9:71693003-71693025 ACTTAAGTTCCGGAGCTGGATGG + Intronic
1056172478 9:83999622-83999644 TCTTAAGTGCAAGAGTTTGATGG - Intronic
1056944735 9:90984630-90984652 CTTTAAGTCCATGAGCTGCAGGG - Intergenic
1057043496 9:91865223-91865245 TCTTAAGCCCATCAGCTGGCAGG + Intronic
1057197184 9:93121657-93121679 TCTTAAGTGCCTGGGCTTGGTGG - Exonic
1186882430 X:13879770-13879792 TCTGAGGTGCATCAGCTGGAGGG + Intronic
1187358952 X:18606464-18606486 TCTTAAGTGTGTGGGCTGGCAGG + Intronic
1187432418 X:19237202-19237224 TCTTAGGTGCCTGTGCAGGAAGG - Intergenic
1189620890 X:42835997-42836019 TATGAACTGCATTAGCTGGATGG - Intergenic
1190035761 X:47022186-47022208 TCTTTAGTGCATGGCCTAGAAGG - Intronic
1190497895 X:51044265-51044287 TCTTAGGTGCAGGAGTGGGAGGG + Intergenic
1190927095 X:54920348-54920370 TCTGAATTGCATAAGATGGACGG + Intergenic
1194320009 X:92434622-92434644 TCTTAAGCCCAGGAGTTGGAGGG - Intronic
1197073407 X:122326770-122326792 ACTTAAGAGCAAGAGCTGGCAGG - Intergenic
1197385865 X:125800639-125800661 TCTTAAGAGCATAAGCTTGAGGG - Intergenic
1199808223 X:151323350-151323372 TCTTCAGTGCAGGAGCAAGAAGG - Intergenic
1200628129 Y:5547756-5547778 TCTTAAGCCCAGGAGTTGGAGGG - Intronic