ID: 1003578821

View in Genome Browser
Species Human (GRCh38)
Location 6:7321014-7321036
Sequence GGATGGGAATGGAGGCCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003578813_1003578821 12 Left 1003578813 6:7320979-7321001 CCGTAATGGAACTGCACTGACAG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003578821 Original CRISPR GGATGGGAATGGAGGCCAGA CGG Intronic
No off target data available for this crispr