ID: 1003579284

View in Genome Browser
Species Human (GRCh38)
Location 6:7325080-7325102
Sequence CTGTGGGAGTGGAGAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 974
Summary {0: 1, 1: 0, 2: 7, 3: 108, 4: 858}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003579284 Original CRISPR CTGTGGGAGTGGAGAGAGAA GGG (reversed) Intronic
900204606 1:1426647-1426669 GGGTGGGGGTGGGGAGAGAACGG + Intronic
900327137 1:2113908-2113930 GTGTGGGAGTGTAGAGAGGGCGG + Intronic
901216654 1:7559003-7559025 CTTTGGGAGAGGAGGGACAAAGG + Intronic
901679740 1:10906146-10906168 CTGTGGGGGTGGGGAGAGCCTGG + Intergenic
901712969 1:11130168-11130190 AAGTGGAAGTGGAGAGAAAAAGG + Intronic
901765069 1:11494846-11494868 ATGGGGGAGTGGAGAAGGAAGGG + Intronic
902259891 1:15216877-15216899 CTGTGGGATTGGAGAGGGGTAGG + Intronic
902380811 1:16051455-16051477 CTGTGGGAGTGGGGAGCCCAGGG - Intronic
902521866 1:17022802-17022824 CTCTGGGAGTGCAGAGGAAAGGG + Intronic
903109425 1:21117599-21117621 CTGAGGGAGGTAAGAGAGAAAGG + Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903186274 1:21631084-21631106 GGGTGGGATAGGAGAGAGAAGGG - Intronic
903295835 1:22342696-22342718 CAGAGGGAGTGGACAGAGAGAGG + Intergenic
903378651 1:22882246-22882268 CTGTGGGATCAGAGAGGGAAGGG - Intronic
904163177 1:28536191-28536213 CTGTGGGAGGAGATTGAGAAGGG + Intronic
904271975 1:29356109-29356131 CTGTGGAAGTAGGAAGAGAAGGG - Intergenic
904434221 1:30483835-30483857 AGGTGGGGGTGGAGAGAGAGAGG + Intergenic
904674703 1:32191805-32191827 CTGTGTCAGGTGAGAGAGAAGGG - Intronic
904810320 1:33159605-33159627 CAGTGGGAGTGGAGGCAGATGGG - Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905118957 1:35666992-35667014 CTTTGGGAGTGGAGGAAGAAGGG + Intergenic
905328980 1:37178925-37178947 ATGTGGAAGTGTGGAGAGAAAGG + Intergenic
905361582 1:37424512-37424534 CTGTGGAGTGGGAGAGAGAAAGG - Intergenic
905519898 1:38589606-38589628 CTGGGGGAGTGGAGGGTGTAGGG - Intergenic
905866836 1:41381372-41381394 GTGTGGGAGTGGGGAGGGATGGG + Intronic
906252476 1:44321353-44321375 CTGAGGCAGAGGGGAGAGAAGGG + Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906495228 1:46301006-46301028 CAGTGGTAGGGGAGGGAGAAGGG + Intronic
906609652 1:47192547-47192569 CTTTGGGAGTGGTGGGGGAAGGG + Intergenic
906680216 1:47721200-47721222 CTGTGGGAGAGGAAGCAGAATGG - Intergenic
906690480 1:47789601-47789623 CAGAGGAAGAGGAGAGAGAAGGG - Intronic
907271715 1:53295232-53295254 CTGTGGGAGTGAAGAGAGCAGGG + Intronic
907464727 1:54627545-54627567 CTGTGGGAGAGAAGAAAGCAGGG + Intronic
907473547 1:54690251-54690273 CTTTGGGAGTGGGGTGAGAAGGG + Intronic
907866593 1:58405083-58405105 TTCTGGGAGTGGAGAGAGGGAGG - Intronic
908206137 1:61851785-61851807 CTGTGGCAGTGGAAATGGAAAGG + Intronic
908816595 1:68041822-68041844 CTGTGGGAATGGAGAAAGACAGG - Intergenic
909332685 1:74433056-74433078 TGGTGGCAGTGCAGAGAGAAGGG - Intronic
910415895 1:86997746-86997768 CTGTGTGGGTGGGGAGGGAAGGG + Intronic
911015753 1:93330275-93330297 CTGTGGGAAGGGAGAAAGAGAGG - Intergenic
911753309 1:101523649-101523671 CTGTGTGGGTGGCGAGAAAATGG - Intergenic
911780570 1:101870734-101870756 CTGTGGGGGTGTAGGCAGAAAGG + Intronic
911799922 1:102122977-102122999 CTGTGGCGGTGAAGAGAGGATGG + Intergenic
912022007 1:105117309-105117331 CTGTGGTACTGCAGAGAGAATGG - Intergenic
912073777 1:105846952-105846974 CTGATGGACTGTAGAGAGAAGGG - Intergenic
912306747 1:108575802-108575824 CTGAGGGATTGGAGAGAAATGGG + Intronic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
912960593 1:114192170-114192192 CAGTGTGGGTGGAGAGAGAGCGG + Intergenic
912982178 1:114385403-114385425 CAGTAGAAGAGGAGAGAGAAGGG - Intergenic
913051895 1:115124322-115124344 CAGAGAGAGAGGAGAGAGAAAGG + Intergenic
913063850 1:115231927-115231949 CTTGGGGAAGGGAGAGAGAAAGG - Intergenic
913093945 1:115498553-115498575 CTGGGGGAGTGGGCAGAGACAGG + Intergenic
913162223 1:116154640-116154662 GTGTCAGAGTGGGGAGAGAAAGG - Intergenic
913367273 1:118053902-118053924 CAGTGGGAGTGGATAGTGATTGG - Intronic
913509678 1:119550316-119550338 CTGTTAGAATGGAGAGAGGAAGG + Intergenic
913689201 1:121262388-121262410 CTCTGGAGGTGGAGAGGGAAGGG + Intronic
914148398 1:145017893-145017915 CTCTGGAGGTGGAGAGGGAAGGG - Intronic
914227125 1:145729789-145729811 GTGTGGAAATGGAGTGAGAATGG - Intronic
915148012 1:153806802-153806824 CTGGAGGAGTGGGGAGAAAAGGG + Exonic
915226991 1:154418788-154418810 CTGTGGGGGAAGGGAGAGAAAGG + Intronic
915268627 1:154735882-154735904 CTGTGGGAGGGGACACAGAAGGG + Intronic
915275196 1:154783686-154783708 CTGTGGGACTGGAAGGAGAGGGG + Intronic
915312306 1:155010809-155010831 GTGGGGGGGTGGAGGGAGAAAGG + Intronic
915460187 1:156065888-156065910 CTGAAGGAGTGGAGAGATAAGGG - Intronic
915599724 1:156914575-156914597 CAGTGGGAGTGGAGGGAGTGGGG + Intronic
915645916 1:157272249-157272271 ATGTGGGAGTAGGGATAGAAGGG - Intergenic
915744586 1:158146199-158146221 CTGAGGCACTTGAGAGAGAATGG - Intergenic
915974433 1:160375650-160375672 CACTGGGGGTGGAGAGGGAAGGG - Intergenic
915997329 1:160576491-160576513 CTGTGGGTGGGTATAGAGAAAGG + Intronic
916171343 1:162003637-162003659 GGGTGAGAGTGGAGAGAGCAAGG - Intronic
916171345 1:162003657-162003679 GGTTGGGAGTGGAGAGAGCAGGG - Intronic
916617734 1:166459979-166460001 GTGTGGGAGTAGACAGGGAAAGG - Intergenic
917722303 1:177797249-177797271 CTCTTGTAGTGGAGAGATAAGGG + Intergenic
917921136 1:179750936-179750958 ATGTGAGAGTTGGGAGAGAAGGG + Intronic
917961597 1:180149948-180149970 ATGTGTGTGTGGAGGGAGAAGGG - Intergenic
918147739 1:181772342-181772364 GTGGGGGTGTGGAGAGAGGAGGG - Intronic
918597045 1:186306742-186306764 CCTTGGGAGTGGTGAGAGCAGGG - Exonic
919206488 1:194425882-194425904 CTCTAGTAGTTGAGAGAGAAGGG - Intergenic
919588308 1:199466906-199466928 CTTTGGGAGAGGAAAAAGAAAGG + Intergenic
919758754 1:201083323-201083345 CTGAGGGAGGGGACAGAGGATGG + Intronic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
919972652 1:202591046-202591068 CTGTGGGTGTGGAGAGTGGGAGG + Exonic
920095987 1:203487173-203487195 GGGTGGGGGAGGAGAGAGAAGGG - Exonic
920308754 1:205035685-205035707 CTGTGGATCTGGAGAGTGAATGG + Intergenic
920476524 1:206280863-206280885 CTCTGGAGGTGGAGAGGGAAGGG + Intronic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
920716729 1:208347167-208347189 CCATGGGGGTGGAGAGGGAAGGG - Intergenic
921384122 1:214552057-214552079 ACGTGGAAGTGGAGAGAGCAAGG + Intronic
921610696 1:217209290-217209312 AGGTGGGAGGAGAGAGAGAATGG - Intergenic
921685995 1:218089789-218089811 ATGGTGGAGTGGAGAGAGGAGGG - Intergenic
922496050 1:226058813-226058835 GTGCAGGAGTGGAAAGAGAAAGG + Intergenic
922585630 1:226733097-226733119 CTGTGTGAGTGGGGTGAGCAAGG + Intronic
922999889 1:229998460-229998482 CTGTGAGGGTCCAGAGAGAAGGG + Intergenic
923738639 1:236635498-236635520 CTGTTGGAATGGAGAGGGTATGG + Intergenic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063362402 10:5469160-5469182 GGGAGGGAGTGGAGGGAGAAAGG - Intergenic
1063376033 10:5554974-5554996 CTGCTGAAGTGGAGAGAAAAGGG + Intergenic
1063469808 10:6275247-6275269 CTCTGGAAGAGGACAGAGAAGGG - Intergenic
1063536128 10:6885438-6885460 CTGAGGCAGTGGGGAGAGAGAGG + Intergenic
1064364435 10:14694350-14694372 CGGTGAGAGTGCAGAGAAAAGGG - Intronic
1064714745 10:18165257-18165279 CTGTGGAAGGGCAGAGAGGAGGG + Intronic
1065167495 10:22994754-22994776 CTGTGGGAGGATGGAGAGAAGGG + Intronic
1065838681 10:29682002-29682024 CTGAGGGAGTGGGGACAGGAAGG - Intronic
1065911955 10:30315187-30315209 ATTGGGGAGAGGAGAGAGAAAGG - Intronic
1065990072 10:31000454-31000476 TTGTGGGGGTAGAGAGAAAAAGG - Intronic
1067100828 10:43333253-43333275 CTGTGGGAGTGGGCAGAGATGGG - Intergenic
1067687278 10:48473933-48473955 CTCTCTGAGAGGAGAGAGAAGGG - Intronic
1070066973 10:73045386-73045408 ATCTGGGGGTGGGGAGAGAAGGG + Intronic
1070362535 10:75704877-75704899 CAGTGAGAGAGGAGAGGGAAAGG + Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070794733 10:79210042-79210064 CTGGGGGGGCGGAGGGAGAAGGG - Intronic
1071129353 10:82373388-82373410 ATGTGGATGTGGAGAGACAAAGG + Intronic
1071346016 10:84694042-84694064 CAGAAGGAGAGGAGAGAGAAAGG + Intergenic
1071456503 10:85855327-85855349 CCCTGGGCTTGGAGAGAGAAAGG - Intronic
1071460728 10:85892303-85892325 ATGAGGGAGAAGAGAGAGAAGGG + Intronic
1071499278 10:86191936-86191958 TTGAGGGAGTGATGAGAGAAAGG + Intronic
1071515749 10:86295598-86295620 CAGACGGAGTGGAGAAAGAATGG + Intronic
1071933007 10:90495461-90495483 CTGTCTTAGTGCAGAGAGAAAGG - Intergenic
1072147762 10:92657773-92657795 CAGAAGGAGAGGAGAGAGAAAGG + Intergenic
1072456848 10:95583924-95583946 CTGTGGGACTGGTGAAAGGATGG + Intergenic
1073275019 10:102302250-102302272 CTGTGGAAAGGGAGAGGGAAAGG + Intronic
1073518585 10:104102523-104102545 TTGTGGGTGTGATGAGAGAAAGG + Intergenic
1073718168 10:106133129-106133151 CTGTGGTTGTAGAGAAAGAATGG - Intergenic
1073989790 10:109249632-109249654 CTTCAGGAGTGGAGAGAGGAGGG + Intergenic
1074436950 10:113442351-113442373 CTGAGGTAGTGGAGAGAGAAAGG - Intergenic
1074448178 10:113537692-113537714 CTTTGGGAGGGGTGACAGAAAGG - Intergenic
1074463162 10:113657161-113657183 CGGGGAGAGTGGAGAGAAAAGGG + Intronic
1075200476 10:120399266-120399288 AAGTGGAAGGGGAGAGAGAATGG + Intergenic
1075230018 10:120668230-120668252 CTGTGGAAGTGGACAAAGCAAGG - Intergenic
1075356239 10:121779475-121779497 CAGTGGGAGTGAAGATAAAACGG - Intronic
1075536496 10:123276033-123276055 CGGGGGGAAGGGAGAGAGAAGGG + Intergenic
1075602181 10:123777789-123777811 ATGGGGGATGGGAGAGAGAAGGG - Intronic
1075894640 10:125984276-125984298 CTGTAGCAGGGGAGAGAGCATGG + Intronic
1076220313 10:128728501-128728523 TTGTTGGAGTTGAGAGAGGAAGG - Intergenic
1076413080 10:130265583-130265605 CTGTGGGAGGGTAGTGAGAAGGG + Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1077320536 11:1938971-1938993 CTATGGGAGTGGAGAGTGGAGGG - Intergenic
1077423033 11:2461834-2461856 CTGGGTGGGTGGAGAGAGAAAGG + Intronic
1077549322 11:3193097-3193119 CTGTGGGAGGGAAGAGACCAGGG - Intergenic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078612125 11:12830007-12830029 CCTTGGGAGTGGAGAGATAGAGG + Intronic
1078706367 11:13747669-13747691 GGGAGGGAGTTGAGAGAGAAAGG - Intergenic
1078768325 11:14321516-14321538 AAGTGGGAGTGGGGAGAGCAGGG + Intronic
1078858478 11:15225904-15225926 CTGAGGCAGGGGAGAGAGCATGG + Intronic
1079730995 11:23937700-23937722 CTCTGGTATTGGAGAGAGCAAGG + Intergenic
1080271202 11:30452390-30452412 CTGTGGGAATGGAGAAGGTATGG - Intronic
1080695202 11:34597690-34597712 CTGAGGGACAGGAGAGAGGAGGG + Intergenic
1081602413 11:44504416-44504438 GTGTGTGTGTGGAGAGAGTATGG - Intergenic
1081713578 11:45233407-45233429 CTGTGGGGGTGGGGAGAGGTAGG - Intronic
1081738891 11:45424453-45424475 CGGTGGCAGTGCAGTGAGAAAGG - Intergenic
1081797268 11:45829455-45829477 CTGTGGAGGTGGAAAAAGAAGGG - Intergenic
1081986595 11:47309341-47309363 CTGTGATGTTGGAGAGAGAAGGG + Exonic
1082044074 11:47710744-47710766 CTGGTGTAGTGGAGTGAGAAAGG + Intronic
1082786948 11:57322494-57322516 CTGAGGGAGGGGAGAGAGTGGGG - Intronic
1082834173 11:57639769-57639791 CTTAGGGAGTGCAGGGAGAAAGG - Intergenic
1082933981 11:58637853-58637875 AGGTGGGAGAGAAGAGAGAATGG - Intergenic
1083109232 11:60388619-60388641 GTGTGGCAGGGAAGAGAGAAAGG + Intronic
1083205355 11:61145513-61145535 CTGTGGCATTGGTGAGAGAAAGG - Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1084432234 11:69117514-69117536 CTGGGGAAGGGGAGCGAGAAGGG + Intergenic
1084477812 11:69398845-69398867 GTGTGGGGGTGGCCAGAGAAGGG + Intergenic
1084601812 11:70150133-70150155 CCGTGGGGGTGGAGAGGAAATGG + Intronic
1085297736 11:75440356-75440378 CTATGGGAGAGGAGGGTGAAGGG - Intronic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085474750 11:76782946-76782968 CTGTGTGTGTGGAAAGAGAGAGG - Intronic
1085551702 11:77379503-77379525 CTCTGAGAGTATAGAGAGAAAGG - Intronic
1085804566 11:79623245-79623267 CTGTGGGAATTGATAGAGGAAGG - Intergenic
1086243653 11:84725393-84725415 CAGTAGGAGAGGAGAGGGAAAGG - Intronic
1086752075 11:90509066-90509088 TTGTGGGAGGGCAGAGAGAAAGG - Intergenic
1087635609 11:100697864-100697886 CGGTGGGAGTGGAGAGCAAGGGG + Intronic
1088463906 11:110112690-110112712 GACTGGGAGTGGAGAGTGAAAGG - Intronic
1088687660 11:112298405-112298427 ATGTGGGAAAGGAGAGAGAGAGG + Intergenic
1088970539 11:114771224-114771246 TTCTGGGAGTGGAGAGGGAGAGG - Intergenic
1089323489 11:117642020-117642042 CTGTTGGAGTGGGGAGAGGCAGG - Intronic
1089350411 11:117818799-117818821 CTGTGGGTTTGGAGAGTGAAGGG - Intronic
1089413975 11:118271575-118271597 GAGTGTGAGTGGAGAGAAAAGGG + Intergenic
1089430598 11:118421029-118421051 CTCTGGGATAGGAGAAAGAAGGG - Intronic
1089603376 11:119628137-119628159 GGGTGGGAGGGGAGAGAGACGGG - Intronic
1090246562 11:125220399-125220421 GAGTGGCAGTGGAGACAGAAGGG + Intronic
1090454640 11:126837859-126837881 CTTTAGGAGTGTAGAGAGATAGG - Intronic
1090815492 11:130290494-130290516 CAGTGGCAGTGGAGAAAGGAAGG - Intronic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1091592021 12:1848224-1848246 GAGGGAGAGTGGAGAGAGAAAGG - Intronic
1091648840 12:2294485-2294507 CTGGGGCAGTGGAGAGTGAGGGG + Intronic
1091828683 12:3534113-3534135 CAGTGGGAGGGGACAGAGTAGGG - Intronic
1092267458 12:6993539-6993561 CTCTGGGAGTTAAGAGAGAATGG - Intronic
1092604224 12:10101302-10101324 CTGTGTGGGTGGACAGAGAGGGG + Intronic
1092911756 12:13151790-13151812 GTGTGGGAGTGGCTACAGAAGGG + Intergenic
1093018942 12:14185450-14185472 ATGTGGAAGGGAAGAGAGAAGGG + Intergenic
1093025267 12:14239994-14240016 CTGTGGCTGTGGGAAGAGAATGG + Intergenic
1093092877 12:14941035-14941057 CTGTGAGACTGCAGAGAAAAGGG + Intergenic
1093409525 12:18847655-18847677 CAGTGGGAGAAGAGATAGAAAGG + Intergenic
1093414720 12:18907074-18907096 CTGTGGGTGGGGAGAGAGAGGGG - Intergenic
1093783428 12:23164405-23164427 CTGTGGGAATAGAAAAAGAATGG - Intergenic
1093831108 12:23759413-23759435 CTGTGGGGGTGACGAGGGAAGGG + Intronic
1094078829 12:26510010-26510032 GGGTGGGGGTGGGGAGAGAAGGG + Intronic
1095187787 12:39221886-39221908 TTCAGGGAGTGGAGAGGGAAAGG - Intergenic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1096675771 12:53224989-53225011 GAGAGGGAGAGGAGAGAGAATGG - Intronic
1096917440 12:55048335-55048357 CTGGGCAAATGGAGAGAGAATGG + Intergenic
1097008555 12:55936332-55936354 TAGTGGGAGTAGAGACAGAATGG + Intronic
1097128287 12:56790563-56790585 CTGTGGGAAGGGAGAGGGAGAGG + Intergenic
1098078303 12:66757225-66757247 GTGTGGGAGGGAAGAGAGGAGGG - Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098268757 12:68750068-68750090 CGGTGGGAATGGACAGGGAAAGG + Intronic
1099016575 12:77350425-77350447 CTGTGTGTGTGTTGAGAGAAAGG + Intergenic
1099454567 12:82848250-82848272 CTCTGGGACAGGAGAGAGCATGG - Intronic
1099541945 12:83922108-83922130 CTGAGTGAGTGGTGAGTGAATGG - Intergenic
1100089586 12:90954198-90954220 CTGTATGAGTGGAGAGAGCCTGG - Exonic
1100287868 12:93184507-93184529 GGGTGGGGATGGAGAGAGAAAGG + Intergenic
1100717830 12:97324552-97324574 CAGCAGGAGAGGAGAGAGAAAGG + Intergenic
1100767266 12:97881066-97881088 CTGAGGAGGTGGAGTGAGAATGG - Intergenic
1101846160 12:108364808-108364830 CTGTGGGAGTTAAGAGAGGTAGG - Intergenic
1101963422 12:109266213-109266235 CTGTGGGGGAGGTGAGAGGAGGG - Intronic
1102022469 12:109693383-109693405 CTGTGGTAGGAGAGAGAGAGAGG + Intergenic
1102221680 12:111199052-111199074 GGGTGGGTGCGGAGAGAGAAGGG + Intronic
1102394417 12:112574745-112574767 GTGTGGTGGAGGAGAGAGAAGGG + Intronic
1102420395 12:112798848-112798870 CAGGGGCAGAGGAGAGAGAAAGG - Intronic
1102659820 12:114516282-114516304 GTCTGGGGGTGGGGAGAGAATGG + Intergenic
1102703927 12:114864750-114864772 CTGGGAGAGGCGAGAGAGAAAGG + Intergenic
1103014257 12:117481767-117481789 TTATAGGAGTGGAGAGAGAAGGG - Intronic
1103557583 12:121775586-121775608 CTGGGGGAGTCCAGAGAGGAGGG - Intronic
1103633193 12:122279948-122279970 TTGTGGGAGTGAGAAGAGAAAGG + Intronic
1104437189 12:128765723-128765745 CTGTGGGAGCAGAGTGGGAAAGG - Intergenic
1104469859 12:129020973-129020995 CTTTGGGGGTGAAGAGAGGAAGG - Intergenic
1104569464 12:129912324-129912346 CGGTGGGAGAGGAGAGACCAGGG + Intergenic
1104624668 12:130341226-130341248 CAGTGGGACTGGAAAGAGAAGGG - Intronic
1104680999 12:130751854-130751876 CTATGGGTGTGGACAGAGAAGGG - Intergenic
1104732743 12:131117219-131117241 CTTTGGGGGTGGTGATAGAAGGG - Intronic
1105051905 12:133061609-133061631 CTCTGGGATTGGAAAGAGAATGG - Exonic
1105306200 13:19170689-19170711 CTCTGGGGGTGGAGAGACAAAGG - Intergenic
1105580352 13:21689940-21689962 ATGTGGGAGAGGTGAGAGGAAGG - Intronic
1105660179 13:22485396-22485418 ATTTGGGAGTGTATAGAGAATGG + Intergenic
1105814394 13:24021210-24021232 TTCTGGGAGTTGACAGAGAATGG + Intronic
1105821104 13:24081851-24081873 CTGTGGGCGTGGAAAGTGAAAGG - Intronic
1109106462 13:58257928-58257950 TTGGTGGAGTGGAGCGAGAAAGG + Intergenic
1109254067 13:60056781-60056803 CTGGGGGAGTGGGAAGAGATAGG + Intronic
1109400791 13:61825661-61825683 TGGTGAGAGTGTAGAGAGAAAGG - Intergenic
1109930082 13:69205206-69205228 CTGTTGGAGGAGAGAGAGAGAGG + Intergenic
1110689607 13:78416891-78416913 CTGTGGGAGGTGGGACAGAATGG + Intergenic
1111374091 13:87355156-87355178 CTGGGGGAGTGGGTAGAGGAAGG + Intergenic
1111537824 13:89626968-89626990 CAGAGGTAGTGGAGAGGGAAGGG - Intergenic
1111643985 13:91006817-91006839 CTATGTGAGTGCATAGAGAAAGG - Intergenic
1111913103 13:94333776-94333798 CTGTTGCAGTGGAAAGGGAATGG - Intronic
1111999844 13:95199897-95199919 GCGTGGTAGTGGAGAGAGATGGG - Intronic
1112162767 13:96886321-96886343 CTGGGGGAAGGGAGAGAGATGGG + Intergenic
1112302093 13:98239855-98239877 CTGTGCTAGAGGAGAGAGAAAGG + Intronic
1112464122 13:99628869-99628891 GGATGGGAGTGGGGAGAGAAAGG + Intronic
1113536345 13:111069348-111069370 CTGTGGGAGGGGAGAGTGTAAGG + Intergenic
1113556612 13:111240687-111240709 CTGTAGCAGTGGACAGGGAAGGG + Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113595679 13:111530227-111530249 GGGTGGGAGTGGAGGCAGAAAGG + Intergenic
1113662746 13:112118236-112118258 GTGTGGTAGAGGAGAGAGGACGG + Intergenic
1113768340 13:112894316-112894338 CACTGGGCGGGGAGAGAGAAGGG - Intergenic
1113913806 13:113858056-113858078 CTCTGGGAGTGGAGAGACCCTGG + Intronic
1114261435 14:21039392-21039414 CAGTGGGAGAGAAGACAGAAGGG - Intronic
1114388579 14:22281426-22281448 CTGTGGGAAAGAGGAGAGAAAGG - Intergenic
1114532221 14:23403210-23403232 CGGAGTGAGTGGAGGGAGAAGGG + Intronic
1115091159 14:29577548-29577570 CTGTTAGAGTGGAAGGAGAAGGG - Intronic
1115307709 14:31949638-31949660 TTGTGGGAGTACAGAGAGTAGGG - Intronic
1115424304 14:33238387-33238409 CTGTGGGACTACAGAGAGAATGG - Intronic
1116557541 14:46331661-46331683 TTGTAGGAGTAGAGATAGAAAGG + Intergenic
1117084562 14:52186037-52186059 CTATATGAGTGGAGAGGGAATGG + Intergenic
1117314542 14:54561002-54561024 GAGTGGGAGTGGCGTGAGAAAGG + Intergenic
1117336492 14:54760715-54760737 CTGAGGGAGTTGGGAGAGAAAGG - Intronic
1117654210 14:57937981-57938003 CTTGGGGAGTGGAGACAGAGGGG - Intronic
1117839550 14:59845453-59845475 CTGTGGCAGTGGAGAGCAAGAGG - Intronic
1117866923 14:60159755-60159777 CTGGGGGAGGGGAGATAGGAAGG - Intronic
1118262114 14:64257416-64257438 CTGTGTGTGTAGAGACAGAATGG + Intronic
1118753711 14:68823703-68823725 CTCTGGGAGTGAAGAGGGAATGG + Intergenic
1119227448 14:72955230-72955252 CTCTGGGACTTCAGAGAGAAAGG + Intronic
1119266253 14:73264693-73264715 CTGTGGGTGTGAAGAGGGGATGG - Exonic
1120152495 14:81052935-81052957 CTGAGGGAGGGGAGAGGGAGAGG + Intronic
1121630991 14:95421871-95421893 CAGGTGGAGTGGAGAAAGAAGGG - Intronic
1121709905 14:96030154-96030176 CTGAGTGAGTGGACACAGAAGGG + Intergenic
1121817135 14:96937402-96937424 CTTTGGGAGTGGAGAGATAGGGG + Intergenic
1121859048 14:97299340-97299362 CAATGGGGATGGAGAGAGAAGGG - Intergenic
1121939827 14:98059478-98059500 CTGTGAGAGGAGAGAGAGAAAGG + Intergenic
1121953094 14:98189292-98189314 CTGATGGAATGGAGACAGAAGGG + Intergenic
1122179874 14:99947130-99947152 GTTGGGGTGTGGAGAGAGAAAGG + Intergenic
1122376116 14:101259487-101259509 CTATGGGAGTGAAGTCAGAACGG - Intergenic
1122592792 14:102867490-102867512 ATGGGGGAGTTGAGAGAGACTGG + Intronic
1122898161 14:104770692-104770714 CTCTGAGTGTGGAGAGAAAAGGG + Intronic
1123952490 15:25294958-25294980 CTGGGGGAATGTAGAGAAAAGGG + Intergenic
1124340860 15:28888427-28888449 CTGTTGGAGTGGGGAGAGTGGGG + Intronic
1124966237 15:34435194-34435216 CTGTTGGAGTGGGGAGAGTGGGG - Intronic
1124982839 15:34581277-34581299 CTGTTGGAGTGGGGAGAGTGGGG - Intronic
1125061715 15:35433923-35433945 CTGTGGAAGAGAAAAGAGAAGGG + Intronic
1125437698 15:39665069-39665091 CGATGGGAGTGGTGGGAGAAGGG - Intronic
1125815921 15:42584092-42584114 CTTGGGGAGTGGAGAGAGACTGG + Intronic
1127256773 15:57299605-57299627 GGCTGGGAATGGAGAGAGAAAGG + Intergenic
1127417883 15:58774622-58774644 CTATGGAAGTGCAGAGAAAACGG + Intronic
1128403230 15:67307520-67307542 GAGTGGGAGTGGAGAAAGAAGGG + Intronic
1128736975 15:70058877-70058899 CTCTGGGAGTGGGAAGAGAGAGG + Intronic
1129106816 15:73315507-73315529 CTGTGGTAGTGCAAAGAGATTGG + Intergenic
1129209494 15:74059377-74059399 CTGTGGTAATGGGAAGAGAATGG + Intergenic
1129611489 15:77062562-77062584 GTGTGAGGGTGCAGAGAGAAGGG + Intronic
1129627951 15:77224877-77224899 CTGTGGAAATGGAAAGAGATGGG - Intronic
1129639327 15:77358164-77358186 TTGTGGAAGTAGAGAGAGAGAGG - Intronic
1129797158 15:78386593-78386615 GTGGGGGAGTGGAGTGAGACAGG - Intergenic
1129919948 15:79311443-79311465 ACCTGGGAGTGGAGGGAGAAGGG - Intronic
1130121317 15:81050037-81050059 CTGTGGAAATGAAAAGAGAAAGG + Intronic
1130231671 15:82101948-82101970 GAGTGGGAGTGGGAAGAGAAGGG + Intergenic
1130520764 15:84658934-84658956 CTGTGAGAGGGCAGAGAGCAAGG - Intergenic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1131646273 15:94348466-94348488 CAGAGAGAGAGGAGAGAGAAAGG - Intronic
1132285266 15:100658014-100658036 CTGAGGAAGTGGGCAGAGAAGGG - Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1132496185 16:264561-264583 CTGTGGGAGTGCTCAGTGAAGGG + Intronic
1132665209 16:1078386-1078408 AGGTGGCAGTGGAGAGAGATGGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133109151 16:3535318-3535340 TTGTGTGAGGGGAGAGAGACAGG + Intronic
1133308770 16:4829136-4829158 CTGAGGGAGTGGTGAGAGCAAGG - Intronic
1133377795 16:5303622-5303644 CTGTGGTGGGGGAGAGAGGAAGG - Intergenic
1135481890 16:22827488-22827510 CAGTGGTGGTGGAGAGAGAAAGG + Intronic
1136037843 16:27554013-27554035 GGGAGGGAGAGGAGAGAGAAAGG + Intronic
1136253918 16:29025555-29025577 CTGGGGGAGGGGAGAGAGTTTGG - Intergenic
1136480743 16:30540023-30540045 CTGGGGGCCTGGAGACAGAAAGG + Intronic
1136590159 16:31213836-31213858 AGGTGGGAGTGGGGGGAGAAAGG + Intergenic
1137247522 16:46717750-46717772 CTGGGGGAGTGGGGAGTGAGAGG - Intronic
1137253686 16:46758255-46758277 GTGTGTGTGTGGAGAGAGAGAGG - Intronic
1137379696 16:47986038-47986060 CTGTGGAAGAGAAGAGAGAGAGG + Intergenic
1137761268 16:50942394-50942416 CTCAGGGATTGCAGAGAGAATGG - Intergenic
1137930984 16:52587567-52587589 CTGGGAGAGTTCAGAGAGAAGGG - Intergenic
1137975878 16:53031581-53031603 CTGCAGGAGAGGAGAGAGGAAGG + Intergenic
1138037155 16:53620479-53620501 CTGTATTAGTGGAGACAGAATGG - Intronic
1138502753 16:57458231-57458253 CTGAGGGCCTGGAGAGAGAATGG - Exonic
1138982164 16:62282413-62282435 CTGTGAGACTAGAGAGTGAATGG + Intergenic
1139372927 16:66479772-66479794 CAGTGGCAGTGGGAAGAGAAAGG + Intronic
1139458830 16:67106166-67106188 ATGTGGGAGATGAGAGAGACTGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139648191 16:68347107-68347129 CTGGGCAAGTGGAGTGAGAAGGG + Intronic
1139759318 16:69171670-69171692 CTGTGGGAGAGGGGAGAGGAGGG + Intronic
1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG + Intronic
1140663044 16:77206381-77206403 GAGTGAGAGGGGAGAGAGAAGGG - Intronic
1140976482 16:80064537-80064559 CAGGGAGAGTTGAGAGAGAAGGG - Intergenic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141627469 16:85268836-85268858 CTTTGAGTGTGGAGAGAGCACGG - Intergenic
1141669908 16:85486201-85486223 ATGTGTGAGTACAGAGAGAAGGG - Intergenic
1142045869 16:87924936-87924958 CTCTGTGATTGGGGAGAGAAGGG - Intronic
1142223877 16:88867999-88868021 CTGGGGGAGGAGAGAGAGACAGG + Intergenic
1142344517 16:89545462-89545484 CTGTTGGGATGGAGAGTGAAGGG + Intronic
1142475601 17:187258-187280 CTGTGGGATTGGAAAGAGGCCGG + Intergenic
1142806112 17:2372123-2372145 TGGTGGGAGGAGAGAGAGAAGGG - Intronic
1142996107 17:3761521-3761543 CTGTGGGAGGGAAGAGAGGGTGG + Intronic
1143156460 17:4840375-4840397 CTGTGGGAGGGGAAAAAAAATGG + Intronic
1143251275 17:5525003-5525025 CTGATAGATTGGAGAGAGAAGGG + Intronic
1143390591 17:6556972-6556994 CAGAGGGAGCGGAGAGAGGAAGG + Intergenic
1143636133 17:8164500-8164522 CTGTGGGAGGTGAGTGAGCAGGG + Intergenic
1143638918 17:8184145-8184167 CTCTGGGAGTGCAGAAAGACTGG + Intergenic
1143854509 17:9838830-9838852 CTGTGAGATGGGAGAGAGGAAGG + Intronic
1144038712 17:11389588-11389610 CTTTGGGAGAGGAGAGAGGGCGG + Intronic
1144458787 17:15440634-15440656 CTCTGGTAGAGGAGATAGAAAGG - Intronic
1144799313 17:17914141-17914163 CTCTGGGCGTGGACAGAGGAGGG + Intronic
1144810798 17:17997684-17997706 CAGTGGGAGTGGCAAGAGCAGGG - Intronic
1145846719 17:28044655-28044677 CTGTGGAAGGGAAGAGAGGAAGG - Intronic
1146263908 17:31438566-31438588 ATGGGGGTGTGGAGAGAGGAAGG - Intronic
1146635692 17:34502691-34502713 CTGCGGGGGTGGAAAGAGGAGGG + Intergenic
1146659966 17:34659102-34659124 CTCTGGGAATGGGGAGAAAATGG - Intergenic
1146788249 17:35736198-35736220 GAGAGGGAGTGGAGAGAAAAAGG + Intronic
1146835156 17:36104822-36104844 GAGTGGGAGCCGAGAGAGAAGGG + Intronic
1147021444 17:37537184-37537206 CTGGATGAGTGGAGAGTGAAGGG - Intronic
1147186386 17:38715589-38715611 CTGAAGGAGAGGAGAGAGGAAGG - Intronic
1147191322 17:38739684-38739706 TTGGGGGTGTGGAGAGAGAGAGG + Intronic
1147403697 17:40195697-40195719 CTGAGGGAGGGGAGAGGGGATGG + Intergenic
1147600115 17:41740098-41740120 CTGTGGGAGAGGATGGAGACCGG + Intergenic
1148358091 17:46989619-46989641 CTGTGGGAGTGACGATACAAGGG - Intronic
1148460954 17:47838720-47838742 CTGTGGGAGGGGAGAGTGGCTGG + Intronic
1148575082 17:48704758-48704780 TGGTGGGGGTGGGGAGAGAAGGG + Intergenic
1148642828 17:49201123-49201145 CTGTGGGAAATGAGGGAGAAGGG + Intergenic
1149110840 17:53027954-53027976 CGGTGGTAGTGGTGTGAGAAGGG - Intergenic
1149251897 17:54779903-54779925 CTTTGGTAGTAGAAAGAGAACGG + Intergenic
1149338921 17:55666559-55666581 GTGTGGCAGTGTGGAGAGAAAGG - Intergenic
1149444721 17:56704825-56704847 CTGTGGGCCTTGAAAGAGAAAGG + Intergenic
1149526362 17:57359092-57359114 CTCCGGGAGTGGCGGGAGAAAGG - Intronic
1149762031 17:59240853-59240875 CTGAGTGAGTGGTGAGTGAATGG - Intronic
1149919793 17:60646552-60646574 ATGTGGAAGAGGAGACAGAAAGG - Intronic
1150245423 17:63671108-63671130 CTGATGAAGTGGAGAGAGGAAGG + Intronic
1150286218 17:63955729-63955751 CTTAGGGAGTGGGGAGAGAGAGG - Intronic
1150432680 17:65131023-65131045 ATGTGGAAGTGCAGAGATAAAGG + Intergenic
1150653834 17:67026900-67026922 CTGGGGCAGGAGAGAGAGAAAGG - Intronic
1150947568 17:69765300-69765322 CTGGGGGAGGGGAGGGGGAAGGG - Intergenic
1150988318 17:70225381-70225403 CTGAGAGAGCGAAGAGAGAAAGG + Intergenic
1151397788 17:73835855-73835877 GTGGGGGACTGGACAGAGAAGGG + Intergenic
1151552936 17:74832318-74832340 CCCTGGGAGTGGAGAGTGAAGGG - Intronic
1152039065 17:77891627-77891649 CTGTGGGATTGCAGGCAGAAGGG - Intergenic
1152231419 17:79115749-79115771 CTGTGGAAGGAGAGAGAGCAAGG + Intronic
1152524431 17:80879426-80879448 ATGTGGGAGTGGGAGGAGAAAGG - Intronic
1152611573 17:81317450-81317472 CTGGGGGTGTGGATAGAGTAGGG + Intronic
1152854344 17:82655668-82655690 CTGTGGCACAGCAGAGAGAAGGG + Exonic
1153155417 18:2144033-2144055 GTGTGGGAGAGGTGAGAGAGGGG + Intergenic
1153758766 18:8310267-8310289 CTGTGGGAGTGGGGAGACAATGG - Intronic
1154158374 18:11960966-11960988 CTGTGAGGGTGGAGAGAGGAGGG + Intergenic
1155315426 18:24566467-24566489 CTGTAGACGAGGAGAGAGAAAGG + Intergenic
1155410426 18:25538650-25538672 GAGTGGGAGTGAAGAAAGAAGGG + Intergenic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1155906484 18:31458377-31458399 AAGTGGGGGTGGAGAGGGAAAGG + Intronic
1156187351 18:34678452-34678474 CAGTGGGGGTGGAAAGGGAAGGG - Intronic
1156493258 18:37508874-37508896 CTGTATGCTTGGAGAGAGAAGGG + Intronic
1156812176 18:41266044-41266066 ATGTGTGTTTGGAGAGAGAAAGG + Intergenic
1156918106 18:42485365-42485387 GTGTGTGTTTGGAGAGAGAATGG + Intergenic
1157369951 18:47101724-47101746 CTGCGGCAATGGAAAGAGAAGGG - Exonic
1157921921 18:51721907-51721929 CTGCAGGAGTGGAGATGGAATGG - Intergenic
1157990101 18:52484849-52484871 TTCTGTGACTGGAGAGAGAAGGG - Intronic
1158333901 18:56394002-56394024 CTGAGTGAGAGCAGAGAGAAAGG - Intergenic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1159027134 18:63194031-63194053 CTGTGGGAGCAGAGAGCTAAAGG - Intronic
1159436063 18:68418926-68418948 CCGAGGGAGTGGAGAGATCAAGG + Intergenic
1160066632 18:75581495-75581517 CGGTGGGTGTGGGGAGAGAAAGG - Intergenic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1161088712 19:2347159-2347181 GCGTGTGTGTGGAGAGAGAACGG - Intronic
1161088719 19:2347249-2347271 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088726 19:2347343-2347365 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088735 19:2347468-2347490 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088742 19:2347562-2347584 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088749 19:2347656-2347678 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088756 19:2347750-2347772 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088762 19:2347834-2347856 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088765 19:2347875-2347897 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088783 19:2348110-2348132 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088785 19:2348153-2348175 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088787 19:2348196-2348218 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088790 19:2348237-2348259 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088808 19:2348472-2348494 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088819 19:2348654-2348676 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088821 19:2348697-2348719 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088836 19:2348973-2348995 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088857 19:2349292-2349314 GCGTGTGTGTGGAGAGAGAACGG - Intronic
1161088879 19:2349689-2349711 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088883 19:2349775-2349797 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088900 19:2350182-2350204 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088903 19:2350225-2350247 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088907 19:2350315-2350337 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088911 19:2350407-2350429 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161623002 19:5309128-5309150 CTCCGGGGGTGGAGAGAGAAGGG + Intronic
1161645948 19:5453556-5453578 CTGTGGCAGTAGACAGAGCAGGG + Intergenic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161726739 19:5933657-5933679 CTGGAGGAGGGGAGAGACAAGGG + Intronic
1161803619 19:6429830-6429852 CACTGGGAGAGGAGAGAGGAGGG + Exonic
1162343773 19:10107941-10107963 CTGTAGGACAGGAGAGAGGAGGG - Intronic
1162499338 19:11042581-11042603 CTGTTGGAGGGGAAAGTGAAGGG + Intronic
1162858418 19:13487485-13487507 CTGGGGGAGCGGGGAGAGACAGG + Intronic
1163077521 19:14907880-14907902 CTGGGGCAGTTGAGGGAGAAGGG + Intergenic
1163107482 19:15133801-15133823 CTGTAGAAGTGGAGATGGAAAGG + Intergenic
1163297649 19:16422503-16422525 ATGAGGGAGTGGAGAGAAAAAGG + Intronic
1163813139 19:19447220-19447242 CTGGGGGAGTGGAGATGCAAAGG + Intronic
1164404110 19:27927162-27927184 GTGAGGCAGTGGAGAGAGGAAGG + Intergenic
1165445667 19:35855765-35855787 GTGTGGGGGTGGGGAGAGATTGG + Intronic
1166128426 19:40730788-40730810 TTGTGGCAGTGGTGTGAGAACGG - Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166410482 19:42553086-42553108 CTGTGTGAGCTGGGAGAGAATGG + Intronic
1166503803 19:43359278-43359300 AGATGGGAGTGGGGAGAGAAGGG + Intronic
1166506651 19:43375480-43375502 AGATGGGAGTGGGGAGAGAAGGG - Intergenic
1166742641 19:45123560-45123582 CTGTGGGAGCGGACAGAGGGAGG - Intronic
1167153790 19:47725786-47725808 GAGTGGGAGTGGAGAGACAGGGG - Intronic
1167172613 19:47843275-47843297 CTCTGTGGGTGGACAGAGAAGGG - Exonic
1167369889 19:49074146-49074168 CTGGGGGTGTGGAGAGAGGTAGG + Intergenic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167650895 19:50728046-50728068 CTGTGGGCATGCAGAGAGAGAGG + Intergenic
1168075201 19:53977579-53977601 CTGTGGGGATGGGGAGAGAGAGG - Intronic
925276604 2:2653542-2653564 CTGTGGGAGAGAACACAGAAAGG - Intergenic
925363382 2:3295050-3295072 AGGTGTGTGTGGAGAGAGAATGG - Intronic
925363484 2:3295554-3295576 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363649 2:3296338-3296360 GTGTGTGTGTAGAGAGAGAACGG - Intronic
925363670 2:3296447-3296469 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925480184 2:4261812-4261834 CTATGGGATTTGAGAGAGTAAGG + Intergenic
925768624 2:7261208-7261230 TAGTGGGAGGGGACAGAGAAGGG + Intergenic
925825151 2:7841118-7841140 CTGGGGGAGAGGAGAGACCACGG + Intergenic
926216839 2:10911256-10911278 GTGTGGGACTGCAGAGAGATAGG + Intergenic
926757415 2:16247314-16247336 CTTTGGGAGTGGAAAGGGAGTGG - Intergenic
926795852 2:16618251-16618273 AAGAGGGAGTGAAGAGAGAAAGG - Intronic
926918459 2:17915897-17915919 TTGTGGGGAGGGAGAGAGAAAGG + Intronic
927605266 2:24481199-24481221 CTGTTGGTGGGGAGAGAGGATGG - Intergenic
927967782 2:27282373-27282395 CTGTGGGGGTTGGGAGACAAGGG - Intronic
928061373 2:28116573-28116595 CTCTGTGAGTGAAGACAGAAGGG - Intronic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
929083625 2:38146749-38146771 CTGCGGGGGTGGCGGGAGAAGGG - Intergenic
929456332 2:42068808-42068830 CTGTGGTTGTGGAGAAAGAAGGG + Intergenic
929611887 2:43276923-43276945 CTGTGGGAGGTGGGAGAGAAGGG - Intronic
930752172 2:54944981-54945003 ATGGGGGAGGGGAGGGAGAAAGG - Intronic
930752282 2:54945290-54945312 GAGGGGGAGGGGAGAGAGAAGGG - Intronic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931757916 2:65390391-65390413 CTGTGGGACTGGAGTGAGCCTGG + Intronic
931842172 2:66164920-66164942 CTCTGGGGCTTGAGAGAGAAAGG + Intergenic
932216506 2:69969640-69969662 CTGGGGCAGTGGGGAGAGGATGG - Intergenic
932269644 2:70398408-70398430 CCATGGGAGTGGGGAGAGAGAGG - Intergenic
932285501 2:70528484-70528506 TTGGGGGAGTGGGGAGGGAAGGG + Intronic
932322183 2:70830403-70830425 CTAAGGGAGTGGAAGGAGAAGGG + Exonic
932370860 2:71186499-71186521 CGTTGGGATTGCAGAGAGAAAGG - Exonic
932430368 2:71670538-71670560 AGGTGGGAGTGGAGAGAGGAGGG - Intronic
932541635 2:72661145-72661167 CTCTGGGAGGACAGAGAGAAAGG - Intronic
932621294 2:73266064-73266086 ATGGGGGAGAGGAGAGAGAAGGG + Intronic
932808019 2:74799580-74799602 CTGTGGGTGGGGACAGAGAAAGG + Intergenic
933406845 2:81871451-81871473 GGGTTGGAGTGGAGAGAGAAAGG + Intergenic
934557846 2:95296875-95296897 CTGTGGAAGTGGAAAAGGAAGGG - Intergenic
934685104 2:96315425-96315447 CTGTGGGACTTGAGAGAGCAAGG + Intergenic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935393949 2:102585972-102585994 CTGTGAGGTTGGAGAGAGACAGG + Intergenic
935482139 2:103603482-103603504 CAGTGGGAATGGAGAGAGTGAGG + Intergenic
935637238 2:105258712-105258734 GTGTAGGGGTGGGGAGAGAAAGG - Intergenic
935812049 2:106808180-106808202 CACTGGGAGAGAAGAGAGAAAGG + Intronic
936060619 2:109293476-109293498 CACTGGCAGTGGAGAGAGAAGGG - Intronic
936465442 2:112744636-112744658 CTGTGGGAGAGAAGAGAGCAGGG - Intronic
936593677 2:113827516-113827538 CCCTGAGAGTGGAGAGAGCATGG + Intergenic
937239888 2:120453218-120453240 GGGTGGGAGTGGAGGGCGAAGGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937577801 2:123445177-123445199 CTTTAGGAGTGTAGAGACAATGG + Intergenic
938180982 2:129182181-129182203 ATGAGGGAGTGGAAAGAGAAGGG - Intergenic
938270799 2:129969162-129969184 CTGAGGGGGTGGAAAAAGAATGG - Intergenic
938444389 2:131366425-131366447 CTGGGGGAGCAGGGAGAGAATGG - Intergenic
939428448 2:142071816-142071838 CTGAGGTTTTGGAGAGAGAAGGG - Intronic
939688444 2:145227875-145227897 CTGTGAGGGTGGAGAAAGAAGGG + Intergenic
939807014 2:146786509-146786531 ATGTGGGAGTGAACAGGGAAAGG - Intergenic
939852073 2:147315246-147315268 CTCTGGTACTTGAGAGAGAAGGG - Intergenic
941225144 2:162838827-162838849 CTGTGGGGGTGGGGTGGGAAGGG + Intergenic
942005698 2:171697563-171697585 CTTTGGGATATGAGAGAGAAAGG + Intronic
942081233 2:172401330-172401352 CTGTGGCAGAGGAGAGGTAAGGG + Intergenic
942123602 2:172802088-172802110 ATGTGGAGGTGTAGAGAGAAAGG + Intronic
942865326 2:180666668-180666690 TGGTGGGAGTGGGGAGAAAAGGG + Intergenic
944032383 2:195251144-195251166 CTGTGGAATTAGAGAGAGAAAGG + Intergenic
944183671 2:196925639-196925661 CGGTAGGGGTGGAGAGAGAAGGG + Intronic
944191787 2:197010770-197010792 TTATGGATGTGGAGAGAGAAGGG + Intronic
944501046 2:200360552-200360574 CTATCGGAGTGGGGAGAGGAAGG + Intronic
944637210 2:201685982-201686004 GTCTGGCAGTGGAGGGAGAAGGG + Exonic
944866783 2:203870432-203870454 CTGGGGGTGTGGAGAGGGGAAGG + Intronic
944978837 2:205090771-205090793 GAGTGGAAGTGGAGAGAGACGGG + Intronic
945020475 2:205566127-205566149 CTGTGGGAGTTGAGCAGGAAAGG + Intronic
945199507 2:207267063-207267085 AAGTGGGAGTGGGGAGACAATGG + Intergenic
945417874 2:209597787-209597809 GGGTGGGAGTGGGGAGAGATGGG - Intronic
946632795 2:221689443-221689465 CTGTGGGAGTAGAGAAAGAGGGG + Intergenic
946684763 2:222256468-222256490 CAGTGGGAGTGGAGAGGGAGAGG - Intronic
946862209 2:224011031-224011053 CTGTGGGAATGGAGGGGGAGGGG + Intronic
946863371 2:224021233-224021255 CTGTGGAGGTGAAGAAAGAAAGG + Intronic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947015176 2:225611438-225611460 CAGCTGGAGTGAAGAGAGAAAGG - Intronic
947232512 2:227902424-227902446 CTGGGGGAGGGGAGTGGGAAGGG + Intronic
947258093 2:228188858-228188880 CTATGCAAGTGGAGAGAGAGAGG - Intergenic
947274911 2:228379670-228379692 CAGTGGGAGTGAAGTCAGAATGG + Intergenic
947628088 2:231633749-231633771 CTGTGTGAGTGTAGAGACCAAGG + Intergenic
947751946 2:232537493-232537515 CTGTTGGTCTGGAGAGAGTAAGG - Intergenic
947883622 2:233544449-233544471 CTTGGGGAGGGGAGAGAGACAGG - Intronic
948034377 2:234846479-234846501 CTGGGGTAGAGGAGAGACAATGG + Intergenic
948152651 2:235756523-235756545 GAGGGGGAGTGAAGAGAGAAAGG - Intronic
948978538 2:241479899-241479921 ATGAGAGAGTGGTGAGAGAAAGG - Intronic
1168742198 20:201257-201279 CAGTGGGAGTGGGGAGTGCAGGG + Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1168812641 20:715723-715745 ATATGGGAGTGGGGAGAGGAAGG + Intergenic
1168923603 20:1561095-1561117 CTCTGGTAGTGGACAGAGGAAGG + Intronic
1168935234 20:1659382-1659404 CTGTGGGTGTGGAGAAGGAGGGG - Intergenic
1168983225 20:2025581-2025603 GTGTGGGTGTGGGGAGTGAAAGG - Intergenic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169347188 20:4838113-4838135 CAGTGGATGTGGAGAGACAAGGG + Intergenic
1169369648 20:5018873-5018895 CTGTGGCAGTGGGGACAGACAGG + Intergenic
1170064501 20:12296055-12296077 GTGTGGGAATGAAGAGAGATTGG - Intergenic
1170429983 20:16267057-16267079 CTCTGGGGGAGGAGAGATAAGGG - Intergenic
1170612744 20:17928112-17928134 ATGTGGGAGTGGGGAGGTAAAGG + Intergenic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1170820393 20:19752551-19752573 GGGTTGGTGTGGAGAGAGAATGG + Intergenic
1170963818 20:21049045-21049067 CTGGGAGGGTGGAGGGAGAATGG + Intergenic
1171019459 20:21572084-21572106 TTGAGGGAGTGGAGAGAGAAGGG + Intergenic
1172007721 20:31828928-31828950 CAGTGGGAGAGGGGAGGGAAAGG + Intronic
1172428807 20:34873957-34873979 ATTTTGGAGTGGAGAGAGGATGG - Intronic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1172623989 20:36337029-36337051 CTGGGGGAGTCGGGAGAGAGTGG + Intronic
1172635693 20:36408221-36408243 CTATGGTAGGGGAGTGAGAAAGG + Intronic
1172656787 20:36542567-36542589 CTGTGGCAGTGGAGTGGGAAAGG - Intronic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173316394 20:41948620-41948642 CTGTGGGAGTGGGAAGAGACAGG - Intergenic
1173672075 20:44805814-44805836 CTGGGGGTGTGGAGAGAAATCGG + Intronic
1174044547 20:47724242-47724264 CTGTGGGTGGGGAGAAGGAATGG + Intronic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174421986 20:50405285-50405307 CTGTAGGGGTGGCGGGAGAAGGG - Intergenic
1174431592 20:50473774-50473796 TTGGGGAAGTGGAGAGAGAGGGG - Intergenic
1175159790 20:56999747-56999769 CTGTGGGAGGGGACAGAACATGG - Intergenic
1175226063 20:57444657-57444679 GTGTGGGAGCGGAAAGAGGATGG + Intergenic
1175607345 20:60321853-60321875 CTGGGGGAGAGGGCAGAGAATGG + Intergenic
1175624365 20:60478167-60478189 CTGTGTCAGGAGAGAGAGAAAGG - Intergenic
1175778792 20:61669224-61669246 CTGTGGGCCTGGAGAGTTAAAGG + Intronic
1176301137 21:5099576-5099598 CCCTGGGAGTGGAGAGGAAACGG + Intergenic
1177113949 21:17063169-17063191 CAGTGGGATAGGAGACAGAAAGG + Intergenic
1177162512 21:17563407-17563429 CTGAGGGAGGGGTGAGAGATGGG + Intronic
1177276909 21:18923742-18923764 CTGTGAAAGTGGAATGAGAATGG - Intergenic
1177412919 21:20754336-20754358 ATGTGGGACTGGAGAGATGAAGG + Intergenic
1177809842 21:25914369-25914391 CTGTGGTAGTAGTGAGAGATGGG + Intronic
1178379242 21:32094111-32094133 CTCTGGGAGAGGCTAGAGAATGG + Intergenic
1179327351 21:40360948-40360970 CTGTGAGGGTGCAGAGAAAAGGG - Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179855892 21:44162322-44162344 CCCTGGGAGTGGAGAGGAAACGG - Intergenic
1180024811 21:45154965-45154987 CAGTGGGAGGGGAGAGAGATGGG + Intronic
1181371776 22:22424741-22424763 ATGTGGGAGGGGAGAGGGTAAGG - Intergenic
1181473415 22:23154383-23154405 CTGTGGAAGTCCTGAGAGAAGGG - Intronic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1181835602 22:25605497-25605519 CTCTGAGAGTGGAGGGAAAAAGG + Intronic
1181962189 22:26630187-26630209 CTGTGGTAGGGGAGAGAGCATGG + Intronic
1181975564 22:26726903-26726925 CTGAGGGAGTAGAGGGACAAAGG + Intergenic
1182443461 22:30377130-30377152 AGGTGGGAGTGGACAGAGGAAGG + Intronic
1183019885 22:35018553-35018575 CTGTGGGAGGGCAGACAGCAGGG - Intergenic
1183197445 22:36363192-36363214 CTGTTGGGGAGGAGGGAGAAGGG - Intronic
1183264604 22:36817486-36817508 AGGTAGGAGTGGAGAGAGAAAGG - Intronic
1183387673 22:37524472-37524494 CTATGGGACTGGGGAGAGAAGGG + Intergenic
1183485382 22:38085376-38085398 CTGTAGGAGGAGAGAGAGAATGG + Intronic
1183640075 22:39087281-39087303 ATGTGGGAGGTGGGAGAGAAAGG - Intronic
1183718284 22:39547085-39547107 CTGTGGGCATGGAGAGGGAGAGG + Intergenic
1184120171 22:42444829-42444851 CCGTGGGAGAGGAGAGAGGGGGG + Intergenic
1184316253 22:43692784-43692806 CAGAAGGAGAGGAGAGAGAATGG + Intronic
1184406734 22:44304737-44304759 CTGTGGGAGTGGAGAGTGACGGG + Intronic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
949386642 3:3509919-3509941 CTCAGGGGGTGGGGAGAGAAGGG + Intergenic
949907601 3:8871743-8871765 TTCAGGGAGTGGAGAGAGAGAGG - Intronic
950047395 3:9957635-9957657 TTGTGGGAGGGGAGGGAGCAGGG - Intergenic
950083237 3:10238725-10238747 CTTTGGGAGAAGAGAGAGAAGGG - Intronic
950552482 3:13675189-13675211 CAGAGGGAGTGGTCAGAGAAAGG - Intergenic
951362832 3:21744983-21745005 GTGTGGGAGAGCAGAGAGGAAGG - Intronic
951430002 3:22595791-22595813 GTGTGGGACAGGAGAGAGAAAGG + Intergenic
951510728 3:23499130-23499152 CTTTGGGTGGGGAGAAAGAAAGG + Intronic
952712136 3:36442470-36442492 CTGTGGGGATGGACAGAGCAAGG + Intronic
952810268 3:37396381-37396403 CTGTGAGAGTGCAGGGACAAGGG - Intronic
952982480 3:38748830-38748852 CTGTGAGAGTAGAGTAAGAAAGG - Intronic
953569075 3:44057342-44057364 CTCTGGGGGTGGAGAGAGGAGGG - Intergenic
953677903 3:45017583-45017605 GTGTGGCAGTGGAAAGAGAATGG - Intronic
953872804 3:46642132-46642154 CTGTGGGACAAAAGAGAGAAGGG + Intergenic
953976922 3:47389017-47389039 GTGGGGGAGTGGAGTGGGAATGG - Intronic
954145263 3:48631307-48631329 CTGTGGGAGAGGACAGAGTCAGG + Intronic
954225827 3:49180448-49180470 CTGAGTGACTGGAGAGGGAATGG - Intronic
954569379 3:51627767-51627789 CTGTGTAAGAGGAGAGGGAAAGG + Intronic
955120306 3:56051422-56051444 GGGTGGGAGTGCAGAGAGAGAGG + Intronic
955259338 3:57369415-57369437 CTGTTGGAATAGAAAGAGAATGG - Intronic
955279126 3:57577657-57577679 ATGTGAGAGTGCAGAGGGAAGGG - Intronic
955907844 3:63826367-63826389 CAGTGGGAATGGGGAGATAAAGG + Intronic
955947755 3:64211544-64211566 CTGTGTGTGTGGAAAGAGAGAGG + Intronic
956716967 3:72087614-72087636 TTGTGGGGGAGGAGAGAGAGTGG + Intergenic
958037618 3:88189035-88189057 TGGTGGAAGTGGAGAGGGAAAGG + Intergenic
959060038 3:101608318-101608340 CAGAGGGAGGGGAGAGAAAAAGG - Intergenic
959197418 3:103202365-103202387 CTCCGGGAAGGGAGAGAGAAAGG + Intergenic
959578495 3:107960723-107960745 CAGTGGGGAGGGAGAGAGAAAGG + Intergenic
959739636 3:109702431-109702453 TTGTGGGAGGGGAATGAGAATGG + Intergenic
959897785 3:111624658-111624680 CAGTGGGAATCGAGAGTGAAGGG + Intronic
959950355 3:112174483-112174505 CTGTGGCAGTGGAGGGAGCGGGG + Intronic
960203780 3:114870429-114870451 ATATGGGATTGGAGGGAGAATGG - Intronic
960292599 3:115904595-115904617 ATCTGGGAGAGGTGAGAGAAGGG - Intronic
960424378 3:117488103-117488125 ATGTGTGAGTGAAGAGAGACAGG - Intergenic
960569463 3:119171374-119171396 CTGTGTGAGTGGCCAGAGAGAGG - Intronic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
960794655 3:121472848-121472870 TAGTGGGAGGGAAGAGAGAAGGG - Intronic
960844983 3:121996842-121996864 CTGTAAGAGTGGAGAGGGGATGG - Intronic
960995845 3:123339570-123339592 TTGTGAGAGTGGAGAGAGCACGG - Intronic
961012402 3:123445225-123445247 CAGTGGGGGTGGGGAGAGAAGGG + Intronic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961073527 3:123961094-123961116 CTGTGGGGATGGAGAGGGACAGG - Intronic
961172679 3:124809318-124809340 TTGTGTGAGTGCAGAGAGAAGGG - Intronic
961310041 3:125990726-125990748 CTGTGGGGATGGAGAGGGACAGG + Intergenic
961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG + Intergenic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
962951104 3:140219683-140219705 CTGTGGAATTGGAGACAGCAGGG + Intronic
963065789 3:141263236-141263258 CTGTGGAAGTGGAGGTAGTAAGG + Intronic
963275322 3:143324281-143324303 CTGTGGGAATGGAGAGGGAGAGG - Intronic
963542759 3:146615187-146615209 CTGAGGATGTGGAGAGAGATGGG - Intergenic
963992083 3:151667068-151667090 CTCTGGTATTTGAGAGAGAAGGG + Intergenic
964465745 3:156989810-156989832 CTGTGTGTGTGCAGAGAGAGAGG - Intronic
964928838 3:161990676-161990698 CTGTGGGAAGGGACAGATAAAGG - Intergenic
965172830 3:165290163-165290185 CTGTGAGATTGTAGAGAAAAAGG - Intergenic
965488960 3:169313485-169313507 CTGCAGGAGGTGAGAGAGAATGG + Intronic
965491915 3:169348156-169348178 ATGTGAGAGTGGAGAAAGATGGG + Intronic
965661031 3:171042202-171042224 GGGTGGAAGGGGAGAGAGAAAGG + Intergenic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966930687 3:184673585-184673607 CTTTGGAAGTGGGGTGAGAAAGG + Intronic
967408700 3:189145449-189145471 TTCTGGCATTGGAGAGAGAATGG + Intronic
967943905 3:194787141-194787163 CTGTGGGAATGGAGAGGGAGGGG + Intergenic
968577774 4:1375953-1375975 CTGTGGGGGTGGGGAGGGAGAGG + Intronic
968957383 4:3726218-3726240 CAGAGGGAGAGGAGAGAGAGAGG + Intergenic
969331573 4:6476270-6476292 CCATGGAAGTGGAGAGAGAGGGG - Intronic
969432335 4:7162709-7162731 CTTAGGGAGTGGAGGAAGAAGGG + Intergenic
969456622 4:7303873-7303895 CTGAGAGTGTGGGGAGAGAAAGG + Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
969571371 4:8010683-8010705 CTCTGTGAGTGGGGAGAGCAGGG - Intronic
969577490 4:8045111-8045133 GTGGGAGGGTGGAGAGAGAAGGG - Intronic
969593414 4:8134417-8134439 CTGTGGGTGTGGAGAGGGAGGGG - Intronic
969973984 4:11078851-11078873 ATGTGGGAGGGAAGAAAGAAAGG + Intergenic
970347022 4:15162229-15162251 ATGTGGGAGTGGTGTGATAATGG + Intergenic
970437793 4:16052265-16052287 CTGTGGGAGTGCAGTGAGTAAGG - Intronic
970843501 4:20505911-20505933 TTGTAGAAGTGGAGACAGAATGG + Intronic
971021765 4:22544208-22544230 TGGTGGGAGTGGAGAGGAAATGG + Intergenic
971116240 4:23648795-23648817 GTGGGGAAGTGGAGAGAAAATGG - Intergenic
971453485 4:26821863-26821885 AGGTGGAAGTGGAGAGAGAAGGG - Intergenic
971460449 4:26890249-26890271 GTGTGGGCTGGGAGAGAGAAGGG + Intronic
972130557 4:35827907-35827929 CAATGGGACTGGAAAGAGAAAGG - Intergenic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
972272260 4:37522877-37522899 CTTGAGGAGAGGAGAGAGAAGGG - Intronic
972469512 4:39390223-39390245 TTGTGTGTGTGGAGAGAGAGAGG - Intergenic
973339531 4:48989665-48989687 CTGTGGGAGGCCAGGGAGAATGG - Intronic
974117503 4:57598143-57598165 CTATGGGAGCAGAGAGAAAAGGG + Intergenic
975294576 4:72718144-72718166 CTGGGGGAGTTGAAGGAGAATGG + Intergenic
977459613 4:97308957-97308979 TTGGGGCAGGGGAGAGAGAAGGG - Intronic
978154915 4:105478404-105478426 CTTTGAGAGTGGAGAGTGGATGG + Intergenic
978339070 4:107702544-107702566 CTGTAGAAGTAGAGAGTGAATGG - Intronic
978919226 4:114162263-114162285 AGGTGAGAATGGAGAGAGAAAGG + Intergenic
979054210 4:115976179-115976201 CGGGGGGAATGGAGAGATAATGG + Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980740009 4:136938293-136938315 CTGGGTAAGTGGAAAGAGAAGGG + Intergenic
980794471 4:137663164-137663186 CAGTGGGTGGGGAGAGAGAGTGG - Intergenic
980866397 4:138558130-138558152 GTGTGTGTGTGGAAAGAGAAAGG + Intergenic
980872729 4:138627941-138627963 CTGGGGGGGTGGTTAGAGAATGG + Intergenic
981113744 4:140965750-140965772 GTGGGGGAGTGGAGAGAAAATGG + Intronic
981290134 4:143065408-143065430 CGGTGAGGGTGCAGAGAGAAGGG - Intergenic
981519932 4:145650793-145650815 CTGTGAGAGTGAGGAGAGGATGG + Intronic
981558983 4:146026427-146026449 CTTTGGGAGTAGAGAGGCAAGGG + Intergenic
981616122 4:146646804-146646826 TGGTGGGAGTGGAGGGAGAGAGG - Intergenic
981857977 4:149317794-149317816 GTGTTGGAGTGGAGTGAGAGAGG - Intergenic
982774263 4:159425971-159425993 CTGTGGGAGGGTAGAGCGATAGG - Intergenic
983587676 4:169373386-169373408 CTGGGTGAGTGGTGAGTGAATGG + Intergenic
983604270 4:169568225-169568247 TTGTGGGGGTAGAGAGAGATGGG - Intronic
984413140 4:179422382-179422404 TTTTGAGAGTTGAGAGAGAAAGG - Intergenic
984770175 4:183430579-183430601 CTGTGGGACAGCAGAGAGAAGGG + Intergenic
984999322 4:185469216-185469238 CAGTAGGAGAGTAGAGAGAAGGG + Intronic
985138928 4:186819247-186819269 TTGAAGGAGAGGAGAGAGAAAGG - Intergenic
985677938 5:1242056-1242078 CTTTGGCAGTGGAGACAGAAGGG + Intronic
985917044 5:2930147-2930169 CAGTGGGAGAGGAGAAAGCAAGG - Intergenic
985930387 5:3052394-3052416 AAGTGGGAGAGGAGAGACAAAGG + Intergenic
986232160 5:5876161-5876183 TGGTGGGAGGGGAGAGAGAGAGG - Intergenic
986249336 5:6042510-6042532 CTGTGGGTGGGGAGAGGGACAGG + Intergenic
986685236 5:10270582-10270604 GTGGGGGAGGGGAGAGGGAAGGG + Intergenic
987060759 5:14241458-14241480 CTATGGGAGTGGTCTGAGAAGGG + Intronic
987316811 5:16731680-16731702 CTGTGGAATTGGAGACAGAGAGG + Intronic
987323439 5:16791290-16791312 CTGTGGGAATTAAGAGAAAATGG - Intronic
987712763 5:21523849-21523871 ATGTGGGAGTAGAGTTAGAAGGG - Intergenic
987752766 5:22063373-22063395 CTGTGTGATGGAAGAGAGAAGGG - Intronic
987962052 5:24823558-24823580 CAGTGGGAGGGGGAAGAGAAAGG - Intergenic
989306058 5:39957242-39957264 GTGGGGGTGGGGAGAGAGAAAGG + Intergenic
989435794 5:41411500-41411522 CTGTGAGATTGGAGAGCAAAAGG - Intronic
989993134 5:50792779-50792801 CAGTGGAAGTGGTGAGAAAAGGG - Intronic
990332229 5:54739518-54739540 ATGAGGCAGTGGAGAGAGATGGG - Intergenic
990763709 5:59159234-59159256 CTGGGGGAGTTGAGATAGGAGGG - Intronic
991172997 5:63650352-63650374 CTGTGGGTGGGGTGACAGAAAGG - Intergenic
991323380 5:65401911-65401933 ATGTGGTAGTGGAGACAGTAAGG - Intronic
991619059 5:68526209-68526231 ATATGGGAGTGGACAGGGAAAGG + Intergenic
992005442 5:72472926-72472948 CTGTGGGAGTTGAGAGGAAGGGG - Intronic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992342720 5:75842377-75842399 CTGGGAGTGTGGAGAGATAAGGG - Intergenic
992441485 5:76801274-76801296 CTGTGTGGCTGGAGAGAGCATGG + Intergenic
992650970 5:78859804-78859826 CTGTGGGGGTGGACATAGAGAGG - Intronic
993699708 5:91103950-91103972 TTGTAGGAGAGGAGACAGAAAGG + Intronic
993893447 5:93502989-93503011 CTATGGGAAAGGAGAGAAAAGGG + Intergenic
994132516 5:96246565-96246587 CTGTGCCAGTGGAGTGAGAAAGG - Intergenic
994961705 5:106613713-106613735 CGGTAGGGATGGAGAGAGAATGG + Intergenic
995232674 5:109786939-109786961 CTATGGCAGAGGAGAAAGAAGGG - Intronic
995441695 5:112199328-112199350 TTCTGGGAATGAAGAGAGAAGGG + Intronic
995942577 5:117601392-117601414 CTTTGAGAGTGGAGAGATAAGGG + Intergenic
996092682 5:119366095-119366117 AAGTAGGAGTGGAGAGAGAGAGG + Intronic
996347387 5:122501762-122501784 CTGTGGTGGTGGGGACAGAAAGG + Intergenic
997232893 5:132257134-132257156 GCGTGGGAGTGGACACAGAAAGG - Intronic
997656355 5:135557653-135557675 CTGCTGCAGTGGAGAGAGGATGG + Intergenic
997668019 5:135647931-135647953 CTGTGGTTGTAGAGAGAGGAAGG + Intergenic
998391208 5:141788150-141788172 GTGTGGGGGTGTAGAGGGAAAGG - Intergenic
998585006 5:143418448-143418470 CTGTGTGGGTTGAGAAAGAAGGG - Intronic
999250977 5:150182161-150182183 CTGTGCAAGAGAAGAGAGAAGGG - Intronic
999274303 5:150318822-150318844 CAGTGGGACTGCAGGGAGAAGGG + Intronic
999664957 5:153903338-153903360 CTCTGGGAATGGAGAAAGATGGG + Intergenic
999756824 5:154670724-154670746 GTGTGGGAGTGGGAAGAGAAAGG - Intergenic
999760731 5:154699014-154699036 CTGTGGGATTGCAGAGCGAGGGG + Intergenic
1000380092 5:160621125-160621147 CTGTGAGCGTGGAGAAAGGAAGG + Intronic
1000560502 5:162782816-162782838 CTGGGGGAGTGTTGAGGGAAGGG + Intergenic
1001092053 5:168748768-168748790 TTGTGGGAGCAGAGAAAGAAAGG - Intronic
1001228754 5:169967870-169967892 ATGTGGGAGGAGCGAGAGAAAGG + Intronic
1001634927 5:173202998-173203020 CTGCTGGAGAGGAGGGAGAAGGG - Intergenic
1001883730 5:175269762-175269784 CTGGGGGAAGGGGGAGAGAAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002458211 5:179358051-179358073 CAGTGGGAGTGGGGTGAGGAGGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1002899577 6:1399605-1399627 CTGGGGACCTGGAGAGAGAATGG - Intergenic
1003242783 6:4358952-4358974 CTGCGGTGGGGGAGAGAGAAGGG + Intergenic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1003628823 6:7768192-7768214 CAGTGGGAGAGGAAAGGGAATGG - Intronic
1003630625 6:7783099-7783121 GTGAAGGAGAGGAGAGAGAAAGG + Intronic
1004172224 6:13304319-13304341 CTTTGGGAGTAGTGAGTGAAAGG - Intronic
1004730044 6:18348676-18348698 CTATGGCTGTGGAGAAAGAATGG + Intergenic
1004784941 6:18957814-18957836 TTGTGGGATTCGAGACAGAATGG + Intergenic
1005824210 6:29622828-29622850 ATGAGGGAGAGGAGAGAGAGGGG - Intronic
1005955638 6:30661577-30661599 CTGTGAGAGTTGAGGTAGAAAGG - Intronic
1006118991 6:31792631-31792653 CTGCGGGAGAGGAGGGAGAGGGG - Intronic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1006182919 6:32164656-32164678 AGGTGGGAATGGAGAGAGAGAGG + Exonic
1006187370 6:32189071-32189093 ATCTGGGAGTGGATGGAGAAAGG + Intronic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006630367 6:35426382-35426404 CGTGGGGGGTGGAGAGAGAAAGG - Exonic
1006670170 6:35725490-35725512 CTGGGTGATGGGAGAGAGAAAGG + Intronic
1006765006 6:36497369-36497391 GGGTGGAAGTGGAGAGGGAAAGG - Intronic
1007005916 6:38362122-38362144 CTATGGGAGTAAGGAGAGAAAGG - Intronic
1007167468 6:39839025-39839047 CTGTGGGAGGAGAGAGAGGGGGG - Intronic
1007285545 6:40744822-40744844 CTGGGGGTGGGGAGAGAAAAAGG - Intergenic
1007325042 6:41053301-41053323 CTGAGGGAGAGGAGAGAGGCAGG - Exonic
1007368855 6:41413255-41413277 AGGGGGGAGTGGAGAGGGAAGGG - Intergenic
1007460111 6:42011746-42011768 CTGAGGCAGTGGAGGGAGAGGGG + Intronic
1007461250 6:42020670-42020692 CTGTGGGAATTCTGAGAGAAGGG - Intronic
1007820250 6:44555696-44555718 ATGGTGGGGTGGAGAGAGAAAGG + Intergenic
1008001163 6:46361209-46361231 CTGGGGGAAGGGTGAGAGAAAGG + Intronic
1009003954 6:57758070-57758092 ATGTGGGAGTAGAGTTAGAAGGG + Intergenic
1009435452 6:63613083-63613105 TGGTGGGAATGGAGAGATAAGGG + Intergenic
1010828426 6:80501183-80501205 ATGAGGGAGAGGAGAGAGAGTGG + Intergenic
1012335686 6:98053616-98053638 CAGTAGGAGTGGAGAGAGAGTGG + Intergenic
1012437357 6:99228169-99228191 GTGTGGCAGTGGAGAAAGCATGG + Intergenic
1014252354 6:119127744-119127766 AGTTGGGAGTGGGGAGAGAAAGG + Intronic
1014549890 6:122778504-122778526 AATTGGGAGGGGAGAGAGAAGGG + Intergenic
1015367239 6:132409882-132409904 GTGTGTGTGTGGAGAGAGACAGG - Intergenic
1015689990 6:135911241-135911263 CTGTGGGTGTGGAGATTTAATGG - Intronic
1015705551 6:136083808-136083830 ATGTGGGAGGAGAGAGAGAGAGG - Intronic
1015890887 6:137968587-137968609 CTGTGTGAGTGTAGGGAGAGGGG + Intergenic
1017673242 6:156787878-156787900 CTGCTGGAGTGCAGAGAAAATGG - Intronic
1018346600 6:162905292-162905314 CTGTGTGAATGGAGTGGGAAGGG + Intronic
1018832728 6:167457379-167457401 GTGTGAGAGTGGAGAGAGCAGGG - Intergenic
1018861241 6:167712358-167712380 ATGTGGGCGTGGAGAAGGAAAGG + Intergenic
1019026836 6:168972910-168972932 GTGTGTGTATGGAGAGAGAAAGG - Intergenic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1020654992 7:10918319-10918341 CGGAGGGAGTGGAGAGGAAAGGG - Intergenic
1020926522 7:14333657-14333679 TTTTGGTAGTGGAGACAGAATGG - Intronic
1021203637 7:17753600-17753622 CTTGAGGAGAGGAGAGAGAAGGG - Intergenic
1021210187 7:17841243-17841265 CTGTAGGAGTCAAGGGAGAAAGG - Intronic
1021276681 7:18660721-18660743 TTGAGGGAGTAGAGAGAGCACGG + Intronic
1021309694 7:19078588-19078610 CTGTGGGTGTGTAGGGAGAGGGG + Intronic
1021756534 7:23858223-23858245 CTCTGGTATTTGAGAGAGAAAGG + Intergenic
1022276213 7:28857379-28857401 GTGTGGGGGTGGAGAAGGAAGGG + Intergenic
1022492460 7:30831472-30831494 CTGTAACAGTGGAGAGAGAAAGG + Intronic
1022617386 7:31945767-31945789 CTGAAGGAGAGGAAAGAGAATGG - Intronic
1023186190 7:37535831-37535853 GTGTAAGAGTAGAGAGAGAAAGG - Intergenic
1023871378 7:44264715-44264737 CAGTGGGAGGGGAGAGGGGAGGG - Intronic
1024224934 7:47319314-47319336 CAGTGGGAGTGGAGGTAGACAGG - Intronic
1024268703 7:47626083-47626105 CAGTGAGAGCAGAGAGAGAAAGG + Intergenic
1025189887 7:56888376-56888398 CTGAGTGAGTGGAGACAGATGGG - Intergenic
1025682052 7:63688545-63688567 CTGAGTGAGTGGAGACAGATGGG + Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026129494 7:67608487-67608509 CTGTGGGAGTTCACAGAGTAAGG + Intergenic
1026224246 7:68426741-68426763 ATAGGGGAGTGGAGTGAGAAGGG + Intergenic
1026312045 7:69194826-69194848 CTATGGGAGGGGAGGGAGAGGGG + Intergenic
1026969165 7:74457566-74457588 CTGGGGTAGTGGGGAGAGAGGGG - Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027261507 7:76468057-76468079 CGGGGGGAATGGAGAGAGGAGGG + Intronic
1027718445 7:81706108-81706130 CTCTGTGAGTATAGAGAGAAAGG - Intronic
1027763999 7:82316444-82316466 ATTTGGGAGTGGTGAGAGAAAGG - Intronic
1028849480 7:95520731-95520753 GTGTGGCAGTGGATAAAGAATGG - Intronic
1028898226 7:96065689-96065711 CTGTGGGAGAGGAAAGAGCCGGG - Intronic
1029400472 7:100342280-100342302 GTGGGGGAGGGGAGGGAGAATGG - Intronic
1029409315 7:100398579-100398601 CTGGGTGAATGGATAGAGAAGGG - Intronic
1029452272 7:100647676-100647698 CTGATGGAGAGGAGAGAGAATGG + Intronic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029736261 7:102467566-102467588 CTGTGGGAGTGGGGTGAGTCAGG + Intronic
1031096114 7:117423011-117423033 CAAGGGCAGTGGAGAGAGAAAGG + Intronic
1032158647 7:129492363-129492385 CAGAGGGAGTTGAGGGAGAAGGG - Intergenic
1033000408 7:137498025-137498047 CTCAGGGAGTTGAGAGAAAATGG + Intronic
1033025974 7:137772919-137772941 CAATGGGGGTGGAGAGAGGAAGG + Intronic
1033492846 7:141861279-141861301 CTGTGTCAGTGAAGACAGAAGGG + Intergenic
1033662332 7:143410716-143410738 GTGTGGGAGTAGAGGGAGAGAGG - Intergenic
1033674728 7:143529094-143529116 CTCTGGAAGTGGATAGAGTAGGG + Intergenic
1033697108 7:143800345-143800367 CTCTGGAAGTGGATAGAGTAGGG - Intergenic
1033735452 7:144217415-144217437 CTGTGGCAGTGGAGAGGATATGG + Intergenic
1033747602 7:144333554-144333576 CTGTGGCAGTGGAGAGGATATGG - Intergenic
1034087667 7:148334823-148334845 CTTTGGGAGAGTGGAGAGAAGGG + Intronic
1034113463 7:148561022-148561044 CAGTAGGAGTGTGGAGAGAAAGG - Intergenic
1034246497 7:149648571-149648593 CTGTGGGAGTGATGACAGCAAGG + Intergenic
1034642106 7:152612428-152612450 GTGTGGGGGTGGAGTGAGGATGG - Intergenic
1034841891 7:154405674-154405696 CTCAGGGGGTGGACAGAGAAGGG + Intronic
1034934887 7:155192566-155192588 CTGTGTGAGAGGAGAAAGGAAGG + Intergenic
1035291217 7:157840540-157840562 GTGTGGGAGTGGAGAGGGTACGG + Intronic
1035368708 7:158364759-158364781 CTGTGTGTGTGGACAGAGAGAGG - Intronic
1035911147 8:3567525-3567547 ATGGGGGAGGGGAAAGAGAAAGG + Intronic
1036030698 8:4968602-4968624 CTGAGGGAGGGGAGAGAAACTGG - Intronic
1036656379 8:10679876-10679898 TGGTCTGAGTGGAGAGAGAAAGG - Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037170658 8:15887544-15887566 CTGGGGGAGGGGAGGAAGAAGGG - Intergenic
1037223309 8:16552846-16552868 GTGTTGGAGTTGAGAGAAAAAGG + Intronic
1037385328 8:18333819-18333841 CTGTAGGACGAGAGAGAGAATGG + Intergenic
1037585133 8:20270833-20270855 TTGTGTGTGTGGAGAGGGAAGGG + Intronic
1037694215 8:21209329-21209351 TTGTTGGGGTGTAGAGAGAAGGG + Intergenic
1037744067 8:21629437-21629459 CTTTGGGAGTGAGGAGAAAAGGG - Intergenic
1038239191 8:25792509-25792531 CTGATGGAGTGAAGAGAGGAAGG + Intergenic
1038892549 8:31742792-31742814 CTCTGTGAGAGGAGAAAGAATGG + Intronic
1039589240 8:38733113-38733135 CTCTAGGAGAGCAGAGAGAAAGG - Intronic
1039928145 8:41957992-41958014 CTTGGGGAATGGAGAGGGAAGGG - Intronic
1039977675 8:42381185-42381207 ATGTGGGAGTGGGGAGGGAGGGG + Intergenic
1040796644 8:51295395-51295417 CTCTGGTATTTGAGAGAGAAGGG + Intergenic
1041576332 8:59399940-59399962 CAGAGAGAGGGGAGAGAGAAAGG + Intergenic
1041784790 8:61619920-61619942 CTGTGGGAGAGGACAGAGTCTGG - Intronic
1041806873 8:61861019-61861041 TTTTGAGTGTGGAGAGAGAAGGG - Intergenic
1042083170 8:65078048-65078070 CTTTGGTAGGGGAGAGAGGAGGG + Intergenic
1042099138 8:65255418-65255440 CTGTGGGACTGGAGAAAAAGAGG - Intergenic
1042640520 8:70928867-70928889 CTATAGGAGTTGAGAGAGACAGG + Intergenic
1042852056 8:73226307-73226329 GAGAGGGAGTGGCGAGAGAAGGG - Intergenic
1043387899 8:79766534-79766556 CTTTGGGGGTGGGGAGAGAACGG - Intronic
1044343586 8:91076297-91076319 CTATAGTAGTGGAGATAGAATGG - Intronic
1044483256 8:92718082-92718104 CTGTGGCAGTGGAGAGATAATGG - Intergenic
1044514972 8:93127188-93127210 GTGGGTGAGTGGAGAGTGAATGG + Intergenic
1044722952 8:95168459-95168481 CTCTGCCAGTGGAGAGAGAGGGG + Intergenic
1044835415 8:96290721-96290743 ATGAAGGAGTGGAGAGAGTAGGG - Intronic
1045317827 8:101058665-101058687 CTGTGGGGCTGCAGAGAGAGGGG - Intergenic
1045710339 8:104975648-104975670 GAGTGGGGGAGGAGAGAGAAAGG - Intronic
1045858200 8:106788886-106788908 ATGTGGTAGTGGACAGATAAGGG + Intergenic
1046117230 8:109799016-109799038 CTGTGTGAGTGTAGATGGAATGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048297776 8:133227365-133227387 CAGTGGGAGTGCTCAGAGAATGG - Intronic
1048848305 8:138620370-138620392 ATTGGGGAGTGGGGAGAGAAAGG + Intronic
1049039682 8:140103070-140103092 CTGTGGGAGTGGGGAGCGGCAGG - Intronic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049347759 8:142147847-142147869 GTGTGGGAGTGCAGAGAGGAAGG - Intergenic
1049418328 8:142505603-142505625 CTGTGGCAGAGGAGAGAGTTGGG + Intronic
1049600563 8:143505555-143505577 GTGTGGGAGTGGAGTGGGGAGGG - Intronic
1050001185 9:1078412-1078434 CTGTGGCACTATAGAGAGAAAGG - Intergenic
1050685696 9:8166442-8166464 AAGTGGGAGGGGAGAAAGAAGGG + Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051325164 9:15958980-15959002 CTGAGGCAGTGGAGAGAGACAGG - Intronic
1051935454 9:22438424-22438446 CTCTGGTAGTTGAGAGAGCAAGG - Intergenic
1052470760 9:28893113-28893135 CTGTTGGATTGGGTAGAGAATGG - Intergenic
1053001271 9:34578380-34578402 CTGGGGGAGGGGAGGCAGAAGGG + Intronic
1053417021 9:37953204-37953226 CTGTGGTGGGTGAGAGAGAAGGG + Intronic
1054856875 9:69909980-69910002 CTGTGGGAATTGGGAGGGAATGG - Intergenic
1056268622 9:84924771-84924793 CCATAGGAGTGGAGGGAGAAAGG - Intronic
1057092981 9:92276822-92276844 GTGTGGGAGTGGGGACAGCAGGG + Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058205862 9:102106101-102106123 CTGAGGAAGTTGGGAGAGAAAGG + Intergenic
1059438919 9:114291860-114291882 TTGTGGGAGAGGAGAGGGGAAGG + Intronic
1059658411 9:116377553-116377575 CTGTGGGAAGAGGGAGAGAAAGG - Intronic
1060039560 9:120288086-120288108 CTAAGGTAGAGGAGAGAGAAGGG - Intergenic
1060105524 9:120870424-120870446 CTGGGTGAGTGGAGCGAGCAGGG - Exonic
1060663230 9:125416501-125416523 CCCTGGGAGTGGAGGAAGAAGGG - Intergenic
1060871983 9:127050160-127050182 GTGTGGGAGAGAAGAGGGAAAGG - Intronic
1060877860 9:127096141-127096163 CTGAGGGAGTGGTGGGGGAAAGG - Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061235588 9:129341143-129341165 CTGTGGGACTGGAGAGCCCAGGG - Intergenic
1061279786 9:129590918-129590940 CTGTAGGAGTGGAGTAACAAGGG + Intergenic
1061612706 9:131758626-131758648 CAGTGGAAGTGAAGATAGAAAGG - Intergenic
1061784316 9:133017005-133017027 CTGTGGAAAGGGAGAGAGATGGG - Intergenic
1061794947 9:133081128-133081150 CTGGGGCAGGGGAGAGGGAAAGG - Intronic
1062123619 9:134847862-134847884 CAGAGGGAGTGGGGAGAGGAAGG + Intergenic
1062470452 9:136701288-136701310 AGGTGGGGGTGGAGAGACAAGGG - Intergenic
1062667533 9:137683867-137683889 CTGCGGGGGTGGAGAGTGAGGGG - Intronic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1186114894 X:6294873-6294895 CTGAAGTAGTGCAGAGAGAAAGG + Intergenic
1187733171 X:22277502-22277524 CAGGGGGAACGGAGAGAGAAGGG - Intergenic
1188003174 X:25001035-25001057 CTGTGGGAGGGTTGAGGGAAAGG - Intergenic
1188257546 X:27981035-27981057 TAGTGGGAGAGGAGACAGAAAGG - Exonic
1188325932 X:28800739-28800761 ATGTAGGGGTGGAGAGACAACGG + Intronic
1188400715 X:29740594-29740616 GTGTGGCAGTGGAAATAGAAAGG - Intronic
1188966450 X:36559331-36559353 CTGAGGGTGTGGGGAGAGGAGGG - Intergenic
1189106636 X:38243336-38243358 CTGGGGGAGGGGATGGAGAAGGG + Intronic
1189729010 X:43999384-43999406 TTGTAGGAGTGGGCAGAGAAAGG - Intergenic
1190238933 X:48641629-48641651 GTGTGTGAGTGGTGAGTGAATGG + Intergenic
1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG + Intergenic
1190689052 X:52898307-52898329 CACTAGCAGTGGAGAGAGAAAGG + Exonic
1190696931 X:52957485-52957507 CACTAGCAGTGGAGAGAGAAAGG - Intronic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191861553 X:65669545-65669567 TCCTGGGAATGGAGAGAGAATGG + Intronic
1193711224 X:84882712-84882734 ATGAGGGAAAGGAGAGAGAAGGG + Intergenic
1194598518 X:95889908-95889930 CTGTGGCACTGGAAAGAGAATGG + Intergenic
1195008874 X:100715747-100715769 CTGTGTGTGTGTAGAGAGATGGG - Intronic
1195107801 X:101617380-101617402 GAGTGGGTGTGGAGAAAGAAGGG + Intronic
1195201056 X:102550311-102550333 CTTTGGGAGTAGAGTGGGAACGG - Intergenic
1195431176 X:104791215-104791237 GGGTGGGGGTGGAGAGAGGAGGG - Intronic
1195942732 X:110179017-110179039 GTGTGGAAGATGAGAGAGAAAGG + Intronic
1196585965 X:117428384-117428406 ATGTGGGGATGAAGAGAGAAAGG - Intergenic
1196938155 X:120749999-120750021 CTATGGGAGTGAACAGACAAGGG - Intergenic
1197329970 X:125141595-125141617 AGGTGGAAGTAGAGAGAGAAGGG + Intergenic
1197901142 X:131373676-131373698 GTGTGTGTGTGGAGAGAGAGGGG + Intronic
1197905413 X:131419694-131419716 CTGTGGGAGGGGTGAGGGGAGGG + Intergenic
1198024043 X:132687503-132687525 CTGGGGGAGGGGAGAGTTAATGG + Intronic
1198097364 X:133393110-133393132 AAGTGGGAGAGGAGGGAGAATGG + Intronic
1200915073 Y:8564380-8564402 TTTTGGGAATGGAGATAGAAGGG + Intergenic
1201481970 Y:14449678-14449700 CTGAAGTAGTGCAGAGAGAATGG - Intergenic