ID: 1003583084

View in Genome Browser
Species Human (GRCh38)
Location 6:7360193-7360215
Sequence TCAAGGGCCTTGAGATTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003583084_1003583096 30 Left 1003583084 6:7360193-7360215 CCCCTGAATCTCAAGGCCCTTGA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1003583096 6:7360246-7360268 ATGTTCTGGGGACTAGGGTGTGG 0: 1
1: 0
2: 14
3: 111
4: 607
1003583084_1003583090 17 Left 1003583084 6:7360193-7360215 CCCCTGAATCTCAAGGCCCTTGA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1003583090 6:7360233-7360255 AGTCCATTCTGCCATGTTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 173
1003583084_1003583091 18 Left 1003583084 6:7360193-7360215 CCCCTGAATCTCAAGGCCCTTGA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1003583091 6:7360234-7360256 GTCCATTCTGCCATGTTCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 148
1003583084_1003583094 25 Left 1003583084 6:7360193-7360215 CCCCTGAATCTCAAGGCCCTTGA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1003583094 6:7360241-7360263 CTGCCATGTTCTGGGGACTAGGG No data
1003583084_1003583093 24 Left 1003583084 6:7360193-7360215 CCCCTGAATCTCAAGGCCCTTGA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1003583093 6:7360240-7360262 TCTGCCATGTTCTGGGGACTAGG 0: 1
1: 0
2: 5
3: 25
4: 265
1003583084_1003583089 16 Left 1003583084 6:7360193-7360215 CCCCTGAATCTCAAGGCCCTTGA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1003583089 6:7360232-7360254 AAGTCCATTCTGCCATGTTCTGG 0: 1
1: 0
2: 0
3: 15
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003583084 Original CRISPR TCAAGGGCCTTGAGATTCAG GGG (reversed) Intronic
900227238 1:1539173-1539195 TCAAGGTCATTCAGATTGAGGGG - Intronic
901020559 1:6253087-6253109 TCAAGGGCCGTTTGATGCAGAGG - Intronic
902150736 1:14441093-14441115 TCAAGGCCCTGGGGCTTCAGAGG - Intergenic
904380293 1:30106250-30106272 TAAAGGGGCTTTAGAGTCAGCGG - Intergenic
905943981 1:41886343-41886365 TCAATGGCTTTGAGACTCAAAGG + Intronic
907990768 1:59580249-59580271 TGAAGGGGCTGGGGATTCAGTGG - Intronic
908253091 1:62280545-62280567 TGAAGGGCCATGTGATTCAAGGG + Intronic
908371511 1:63484296-63484318 ACAAGGGACTTGAGAGTCTGTGG + Intronic
908909778 1:69059844-69059866 TCAAGGTCCTTGAGCTCCATGGG + Intergenic
910792391 1:91064803-91064825 TCATGGGACTCCAGATTCAGAGG + Intergenic
911503960 1:98725661-98725683 TAAAGTGCTTTCAGATTCAGGGG + Intronic
912085353 1:105995708-105995730 TCAAGGCCCAGGAGATGCAGTGG + Intergenic
913936841 1:125063721-125063743 TCAAGGCCCCTGAGAAACAGGGG + Intergenic
914312506 1:146479084-146479106 TTAAGAGACTTGAGTTTCAGGGG - Intergenic
914501841 1:148254254-148254276 TTAAGAGACTTGAGTTTCAGGGG + Intergenic
914834716 1:151197605-151197627 TCATGGGCCATGAGTTTGAGAGG + Intergenic
915167433 1:153956211-153956233 TCAAGAGCCTTAGGATTCAGTGG - Intronic
916191361 1:162181625-162181647 TCAAGGGCCTTTTGAATTAGGGG + Intronic
918356967 1:183713856-183713878 TCTAGGGCCTAGGGATACAGCGG - Intronic
919043629 1:192424341-192424363 TCAGGGGCATAGAGATTCAGAGG - Intergenic
919170615 1:193949151-193949173 TCCAGAGGCTTGAGAATCAGGGG + Intergenic
920002997 1:202812065-202812087 TAAATGGCCTTGAGTTTCTGTGG + Intergenic
920418619 1:205814460-205814482 TCAAGGGCCTGCAGACTCACAGG + Intergenic
923845725 1:237729448-237729470 TGAAGGGCCTTGGAAATCAGAGG - Intronic
1062827741 10:584893-584915 TCGCGGGCCCTGAGATTGAGAGG - Intronic
1062827774 10:585038-585060 TCGTGGGCCCTGAGATTGAGAGG - Intronic
1063115651 10:3069442-3069464 TCAAAGGCCTTCAGAAGCAGAGG + Intronic
1063251678 10:4281234-4281256 AAAAGGGCTTTGAGATTCAGGGG + Intergenic
1067143478 10:43676101-43676123 TAAAGGTTCCTGAGATTCAGAGG + Intergenic
1069580120 10:69560071-69560093 TGAGGGCCCTTGAAATTCAGTGG + Intergenic
1070526195 10:77298014-77298036 TCAAGGGCCTTGAAGTTGACTGG - Intronic
1072691183 10:97573130-97573152 TCCTGGGCCTTGAGAGACAGTGG + Intronic
1073457695 10:103647500-103647522 TAAAGGGCCTCTACATTCAGTGG - Intronic
1073637588 10:105215540-105215562 TAAAGGACTTTAAGATTCAGAGG + Intronic
1074237173 10:111597259-111597281 TCTAGGCCCTGGAGATTCAATGG - Intergenic
1075260566 10:120960135-120960157 TCAATGGCCTTTAGATTAAGTGG + Intergenic
1077860543 11:6174781-6174803 GCCAGAGGCTTGAGATTCAGGGG - Intergenic
1078993392 11:16671342-16671364 TGAAGGTCATTGAGATTCAGGGG + Intronic
1079386902 11:19988658-19988680 TCCAGGGCCTTGGCACTCAGAGG + Intronic
1080248041 11:30201591-30201613 TCAAAGGGCTTGAGAACCAGGGG - Intergenic
1084140793 11:67227381-67227403 TCCATGGCCTTCTGATTCAGGGG + Intronic
1086155740 11:83663818-83663840 TCAAGGGCATTGTAATTCCGAGG + Intronic
1090188729 11:124754323-124754345 TCCAGGGCCTGGAGCTGCAGTGG - Exonic
1091960134 12:4687004-4687026 TCAATGGCCTTGAGTTCCAGTGG - Exonic
1102557825 12:113740223-113740245 TTAAGGGCCTTGAGATGGGGAGG - Intergenic
1103611560 12:122127288-122127310 TCAAGGGCCTGAAGCTACAGTGG + Exonic
1104207790 12:126656881-126656903 TCAAGAGTCTAGACATTCAGAGG - Intergenic
1104985207 12:132592679-132592701 TTAAGGGTCTTGAGATGGAGAGG - Intergenic
1105842400 13:24266030-24266052 TTAAGGTTCTTGAGATTGAGTGG - Intronic
1106086559 13:26547739-26547761 CCAAGGAACTTGCGATTCAGTGG - Intergenic
1108545761 13:51491675-51491697 TCAAGGGCTTTAACATTAAGAGG + Intergenic
1112118909 13:96387938-96387960 TCTAGGGCCCTAAGACTCAGAGG - Intronic
1112189878 13:97165875-97165897 TCAAGGCTCTTGATATACAGAGG - Intergenic
1113950777 13:114069878-114069900 TCAGGGGCCGGGAGACTCAGGGG + Intronic
1113973595 13:114209771-114209793 TCATAAGGCTTGAGATTCAGTGG - Intergenic
1116283905 14:42946831-42946853 GCAAGCTCCTTCAGATTCAGGGG + Intergenic
1116802292 14:49455405-49455427 TCAAGGACCTTGAGATGTGGAGG + Intergenic
1121694275 14:95900217-95900239 TCAAGGGCCCTGCAACTCAGAGG + Intergenic
1121969490 14:98343349-98343371 CCTAGGGCTTTGAGATGCAGAGG + Intergenic
1124648788 15:31459493-31459515 TCAGGGGTTATGAGATTCAGAGG - Intergenic
1125646706 15:41278720-41278742 ACAAGGGCCTTGGGAATCAGAGG - Intronic
1128364152 15:66985298-66985320 TGAAGGGGATGGAGATTCAGAGG + Intergenic
1132028428 15:98421521-98421543 CCAAGGGGCTTGGGCTTCAGTGG + Intergenic
1132469925 16:96843-96865 TAAAGGGTCCTGAGATACAGAGG + Intronic
1137405715 16:48187642-48187664 ACGAGGACCTTGAGACTCAGAGG - Intronic
1139208755 16:65055390-65055412 TCTTGAGCCTTAAGATTCAGCGG + Intronic
1141153820 16:81583076-81583098 TAAAGGGCCTTGGCACTCAGAGG + Intronic
1143853946 17:9834670-9834692 TCAGAGGCCTTGAGATTGACAGG + Intronic
1144945366 17:18966953-18966975 TCAGGGGCACTGAGGTTCAGGGG + Intronic
1151367791 17:73628562-73628584 TCATGGGCCTTGAGTGTCTGGGG + Intronic
1152319225 17:79598863-79598885 TCAAAGGTCATGAGATTCTGGGG - Intergenic
1152853750 17:82651975-82651997 TCAAGGACCTTGAGATGGGGAGG + Intergenic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1163986792 19:20961252-20961274 TCAAGGCCCATGGGGTTCAGGGG + Intergenic
927884613 2:26710710-26710732 TCTAAGGCCTTGGGATTCTGAGG + Intronic
930014652 2:46962042-46962064 TCAAGAGGCTTGGAATTCAGTGG - Intronic
930458891 2:51644084-51644106 TCAAGGGCCTTGAGTATCTATGG - Intergenic
931114803 2:59153029-59153051 GCAGGGGCCTTGAACTTCAGTGG + Intergenic
935687709 2:105698661-105698683 TCAAGAGACTGGTGATTCAGAGG - Intergenic
936467965 2:112770686-112770708 ACAAGAGCCTTGATTTTCAGAGG - Intergenic
936602915 2:113917249-113917271 TTGAGGGCCCTGAGATCCAGTGG - Intronic
937790985 2:125961534-125961556 TCCAGTGCCTTCAGATCCAGGGG - Intergenic
939164267 2:138623129-138623151 TCCAGGGCCTGGATATTTAGAGG + Intergenic
939679156 2:145109009-145109031 TCAAGGGCCCCGGGTTTCAGTGG + Intergenic
940996563 2:160156429-160156451 TCGAGAGCCTTGGGTTTCAGAGG - Intronic
1169532412 20:6500000-6500022 ACAAGGGCCTGGAGCTTCTGAGG + Intergenic
1170715295 20:18825857-18825879 TCAAGGGCCTTAAGATAGACTGG + Intronic
1172572531 20:35981886-35981908 TCACTGGCCTTGTGATTCTGTGG - Intronic
1174930331 20:54806433-54806455 TCCAGGGGCTTCAAATTCAGAGG - Intergenic
1174998843 20:55603401-55603423 TCAAGGTTCTTGAGATAGAGTGG - Intergenic
1175133959 20:56809112-56809134 TTAAGGGCCTTAAGATTCCATGG - Intergenic
1175487818 20:59357872-59357894 CCATGGGCCTTGACACTCAGAGG - Intergenic
1178495368 21:33081397-33081419 TCAAGGGTGCTGTGATTCAGTGG - Intergenic
1178808768 21:35861647-35861669 TCCATGCCCATGAGATTCAGGGG + Intronic
1179155007 21:38842062-38842084 TCACTGGCCCTGAGATGCAGGGG + Intergenic
1181432118 22:22888035-22888057 TCATTGGCCTTCAGGTTCAGGGG - Exonic
1183136854 22:35897345-35897367 TCAATGGCCTTGAGTTCCAGTGG + Intronic
953492983 3:43365540-43365562 TCCAGGGCCTTGTTATTCGGCGG - Intronic
954655244 3:52190562-52190584 TCAAGGGTCTTGGGTCTCAGGGG - Intergenic
955942327 3:64158162-64158184 GCATGGGCCTTGAGGTTCACAGG + Intronic
955977764 3:64494482-64494504 TTAAGGGCCTTGAAATTAGGAGG - Intergenic
958707849 3:97678352-97678374 TGATGGGCCATGAGGTTCAGAGG + Intronic
960583283 3:119298326-119298348 GCAAGGGCCTTCTTATTCAGTGG - Intronic
961136007 3:124511949-124511971 TCATGGATCTTGTGATTCAGTGG - Intronic
961515469 3:127430697-127430719 GCAAGGGACTTGAGATTCCAGGG + Intergenic
964667577 3:159191042-159191064 TCAAGGGCACTGAGATTCCTGGG - Intronic
965361134 3:167739622-167739644 TCCAGGGCCTTGAGGTTAAATGG - Intronic
966328538 3:178784286-178784308 ATAAGGACATTGAGATTCAGAGG + Intronic
966691673 3:182747987-182748009 TCAAGGGCCTCCAGCTTCACAGG + Intergenic
969197310 4:5573254-5573276 TCAGGGGCCTTGAGATAGGGTGG + Intronic
969364797 4:6688085-6688107 TCAAGGACATTGAGAAGCAGCGG - Intergenic
971213240 4:24640058-24640080 TCAGGGGCCATGAGACACAGGGG + Intergenic
972548403 4:40104670-40104692 TCAGGGGCCTTTAGAATCAGAGG + Intronic
973927043 4:55749113-55749135 TCAGAGGCCATGAGATTCAAAGG + Intergenic
977116439 4:93034689-93034711 TTATGTGCCTTGATATTCAGGGG - Intronic
977299197 4:95248599-95248621 TAAAGGTCCTTGAGAAACAGCGG - Intronic
977611285 4:99034693-99034715 TTAAGGGACTTGAGCGTCAGTGG - Intronic
978765566 4:112401678-112401700 CCCAGGGCCATGAGATTCACAGG + Intronic
979947725 4:126854492-126854514 TCAAGGAGCTTGTGATTCAACGG - Intergenic
983464962 4:168075734-168075756 TCATGGGCATTGACACTCAGGGG - Intergenic
983562825 4:169118065-169118087 TCCAGGGCCTTGAAAGTCAGTGG - Intronic
984297130 4:177866404-177866426 TCAGGGGCCTTGATCTTCACAGG - Intronic
990674305 5:58166329-58166351 TCAGGGGCTTTATGATTCAGAGG - Intergenic
991094178 5:62721737-62721759 TAAAGGTCATTGAAATTCAGGGG + Intergenic
993738462 5:91506832-91506854 TTAAGGACCTTGAGATGGAGAGG - Intergenic
995430794 5:112074144-112074166 TCAAAGGCCTGGAGAGACAGAGG + Intergenic
997163744 5:131636151-131636173 TCAAGGAGCTTAAAATTCAGTGG - Intronic
997714975 5:136035806-136035828 TCAAGAGCCCTGGGCTTCAGAGG + Intronic
999253367 5:150195809-150195831 TCAAGGTCCTAGAGCTTCAGAGG - Intronic
1002159944 5:177309164-177309186 TGAAGGGCCTTGAGTTTCACAGG + Intronic
1002865862 6:1121885-1121907 TCAAGGGGCATGAGCTGCAGTGG - Intergenic
1003497854 6:6679721-6679743 TCCAGGGCCTGGAGCTGCAGGGG + Intergenic
1003583084 6:7360193-7360215 TCAAGGGCCTTGAGATTCAGGGG - Intronic
1004308008 6:14518690-14518712 TCAAGGGCCTCTAACTTCAGAGG - Intergenic
1004592558 6:17067925-17067947 TCAAGATCCTTGAGATGAAGAGG + Intergenic
1004736744 6:18413977-18413999 TCAAGGGGCTTCATATTGAGTGG - Intronic
1007322914 6:41040181-41040203 ACAAGGGAATTGAGGTTCAGAGG - Intronic
1011621719 6:89249842-89249864 GCAGGAGCCTGGAGATTCAGAGG - Intergenic
1012320696 6:97841310-97841332 TTAAGGGCCTTAAAATTTAGTGG - Intergenic
1014565814 6:122946550-122946572 TCAATTCCCTTGAGAATCAGAGG + Intergenic
1014826187 6:126050977-126050999 TCAAGTGCAGTGAGATACAGGGG + Intergenic
1018240005 6:161764260-161764282 TCAAGGAGCTTGCAATTCAGTGG - Intronic
1019895981 7:3983672-3983694 TGAAGGGCCTTGTGATAGAGAGG - Intronic
1023742372 7:43292387-43292409 CCAGGGGCCTTGTGATACAGAGG - Intronic
1030323901 7:108199737-108199759 TTAAGGGCCTTGAGATGGGGAGG - Intronic
1030636434 7:111954455-111954477 CCAAGGGCCTTCTAATTCAGTGG + Intronic
1034990453 7:155544686-155544708 CAAAGGACCTTGAGATTCCGGGG + Intergenic
1034992799 7:155558825-155558847 GCAAGGGGCTTGAGATGGAGGGG - Intergenic
1036595655 8:10209709-10209731 CCAAGGGCCTAGAGCTGCAGAGG - Intronic
1039881932 8:41630547-41630569 CCCAGGCCCTTGAGACTCAGGGG + Intergenic
1040860975 8:51999113-51999135 TCATTGGCTTTGAGATTCATAGG - Intergenic
1043162066 8:76858098-76858120 ACAAAGGCCTTCAGACTCAGTGG - Intronic
1045332618 8:101168458-101168480 TCAAAGGGCTTTGGATTCAGAGG - Intergenic
1049548954 8:143247467-143247489 TTAGTGGGCTTGAGATTCAGGGG - Exonic
1051089886 9:13393945-13393967 TCTAGGGCCTAGAGCTTCAAAGG + Intergenic
1051878304 9:21813476-21813498 TCAGGGGCTCTGAAATTCAGCGG + Intronic
1053131883 9:35620010-35620032 TCAGGGGCCCTGAGAGTGAGTGG + Intronic
1055166728 9:73205072-73205094 CCAAGGGCCTTGATATTGAATGG - Intergenic
1056008951 9:82304866-82304888 TCAAGGGCTTTGGGATGCTGTGG + Intergenic
1057304022 9:93902229-93902251 TCAAGAGCCTAGAGACTAAGTGG - Intergenic
1057530945 9:95845998-95846020 TCAATGTCTTTGAGAATCAGAGG + Intergenic
1057873379 9:98734463-98734485 TCAGGGGCCATGAATTTCAGAGG + Exonic
1058746991 9:108001379-108001401 TTAAGGACCTTCATATTCAGAGG - Intergenic
1186213416 X:7273877-7273899 ACTAGGGCCTGGAGATTCAGTGG + Intronic
1189730782 X:44018349-44018371 TCAAGGCCCCTGAAATACAGAGG + Intergenic
1189848440 X:45157231-45157253 TTAAGGGCCTGGAGATACACTGG - Intronic
1190230127 X:48575570-48575592 TCAAGGACCGGGAGACTCAGCGG + Exonic
1190401942 X:50045891-50045913 ACAATGTCCTTGATATTCAGAGG + Intronic
1190553640 X:51611827-51611849 GCAAGGGACTTGAGATTTAAAGG + Intergenic
1194358032 X:92912408-92912430 GCCAGGGCCTGGAGATTAAGGGG + Intergenic
1194707179 X:97189795-97189817 TCTAGGGCCTTGCCCTTCAGAGG - Intronic
1194948184 X:100092792-100092814 TGAAGATCATTGAGATTCAGGGG + Intergenic
1195388368 X:104335026-104335048 TAATGGGCTTTGAGCTTCAGAGG + Intergenic
1196746083 X:119072848-119072870 TTAAGGGCCTTGATATTCATTGG + Intergenic
1198423988 X:136497040-136497062 TCAAGGGCCTTGAGCTCCGCGGG - Intergenic
1199935510 X:152569710-152569732 TCAGGGGGCTTGAGAGTGAGTGG - Intergenic
1200666213 Y:6028059-6028081 GCCAGGGCCTGGAGATTAAGGGG + Intergenic
1201586298 Y:15564682-15564704 GCTAGGGCTTGGAGATTCAGTGG + Intergenic