ID: 1003583706

View in Genome Browser
Species Human (GRCh38)
Location 6:7366557-7366579
Sequence CAGCTCCTGATAAAAACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003583700_1003583706 27 Left 1003583700 6:7366507-7366529 CCAGGGGTCTGGAATTTTGGTAC 0: 1
1: 1
2: 3
3: 23
4: 141
Right 1003583706 6:7366557-7366579 CAGCTCCTGATAAAAACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003583706 Original CRISPR CAGCTCCTGATAAAAACCTG GGG Intronic
No off target data available for this crispr