ID: 1003587023

View in Genome Browser
Species Human (GRCh38)
Location 6:7400127-7400149
Sequence ATAATCAATCTTGAGTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 299}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003587023_1003587030 29 Left 1003587023 6:7400127-7400149 CCATTTTACTCAAGATTGATTAT 0: 1
1: 0
2: 0
3: 23
4: 299
Right 1003587030 6:7400179-7400201 TTACTAATCTATAATGGCAGGGG 0: 1
1: 0
2: 2
3: 10
4: 112
1003587023_1003587028 27 Left 1003587023 6:7400127-7400149 CCATTTTACTCAAGATTGATTAT 0: 1
1: 0
2: 0
3: 23
4: 299
Right 1003587028 6:7400177-7400199 ATTTACTAATCTATAATGGCAGG No data
1003587023_1003587029 28 Left 1003587023 6:7400127-7400149 CCATTTTACTCAAGATTGATTAT 0: 1
1: 0
2: 0
3: 23
4: 299
Right 1003587029 6:7400178-7400200 TTTACTAATCTATAATGGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 169
1003587023_1003587027 23 Left 1003587023 6:7400127-7400149 CCATTTTACTCAAGATTGATTAT 0: 1
1: 0
2: 0
3: 23
4: 299
Right 1003587027 6:7400173-7400195 CGTGATTTACTAATCTATAATGG 0: 1
1: 0
2: 0
3: 7
4: 75
1003587023_1003587025 -10 Left 1003587023 6:7400127-7400149 CCATTTTACTCAAGATTGATTAT 0: 1
1: 0
2: 0
3: 23
4: 299
Right 1003587025 6:7400140-7400162 GATTGATTATTCTGGCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003587023 Original CRISPR ATAATCAATCTTGAGTAAAA TGG (reversed) Intronic