ID: 1003588831

View in Genome Browser
Species Human (GRCh38)
Location 6:7419479-7419501
Sequence CTGGGTCATAAGGCTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003588824_1003588831 12 Left 1003588824 6:7419444-7419466 CCTCTTGCTCATGTGGCTGTATC No data
Right 1003588831 6:7419479-7419501 CTGGGTCATAAGGCTGTGGCTGG No data
1003588822_1003588831 14 Left 1003588822 6:7419442-7419464 CCCCTCTTGCTCATGTGGCTGTA No data
Right 1003588831 6:7419479-7419501 CTGGGTCATAAGGCTGTGGCTGG No data
1003588828_1003588831 -10 Left 1003588828 6:7419466-7419488 CCTTGTTTGGATTCTGGGTCATA No data
Right 1003588831 6:7419479-7419501 CTGGGTCATAAGGCTGTGGCTGG No data
1003588823_1003588831 13 Left 1003588823 6:7419443-7419465 CCCTCTTGCTCATGTGGCTGTAT No data
Right 1003588831 6:7419479-7419501 CTGGGTCATAAGGCTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003588831 Original CRISPR CTGGGTCATAAGGCTGTGGC TGG Intergenic
No off target data available for this crispr