ID: 1003600672

View in Genome Browser
Species Human (GRCh38)
Location 6:7514301-7514323
Sequence CAGTCTCAGCACAAGGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003600672_1003600675 0 Left 1003600672 6:7514301-7514323 CCAGATGCCTTGTGCTGAGACTG No data
Right 1003600675 6:7514324-7514346 CTGTTGGATTCAGTAAAGAATGG No data
1003600672_1003600676 12 Left 1003600672 6:7514301-7514323 CCAGATGCCTTGTGCTGAGACTG No data
Right 1003600676 6:7514336-7514358 GTAAAGAATGGTTCTGTCTGAGG No data
1003600672_1003600679 28 Left 1003600672 6:7514301-7514323 CCAGATGCCTTGTGCTGAGACTG No data
Right 1003600679 6:7514352-7514374 TCTGAGGTAGGGATCAGTTAAGG No data
1003600672_1003600678 17 Left 1003600672 6:7514301-7514323 CCAGATGCCTTGTGCTGAGACTG No data
Right 1003600678 6:7514341-7514363 GAATGGTTCTGTCTGAGGTAGGG No data
1003600672_1003600677 16 Left 1003600672 6:7514301-7514323 CCAGATGCCTTGTGCTGAGACTG No data
Right 1003600677 6:7514340-7514362 AGAATGGTTCTGTCTGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003600672 Original CRISPR CAGTCTCAGCACAAGGCATC TGG (reversed) Intergenic
No off target data available for this crispr