ID: 1003600673

View in Genome Browser
Species Human (GRCh38)
Location 6:7514308-7514330
Sequence CCAACAGCAGTCTCAGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003600673_1003600677 9 Left 1003600673 6:7514308-7514330 CCTTGTGCTGAGACTGCTGTTGG No data
Right 1003600677 6:7514340-7514362 AGAATGGTTCTGTCTGAGGTAGG No data
1003600673_1003600678 10 Left 1003600673 6:7514308-7514330 CCTTGTGCTGAGACTGCTGTTGG No data
Right 1003600678 6:7514341-7514363 GAATGGTTCTGTCTGAGGTAGGG No data
1003600673_1003600679 21 Left 1003600673 6:7514308-7514330 CCTTGTGCTGAGACTGCTGTTGG No data
Right 1003600679 6:7514352-7514374 TCTGAGGTAGGGATCAGTTAAGG No data
1003600673_1003600676 5 Left 1003600673 6:7514308-7514330 CCTTGTGCTGAGACTGCTGTTGG No data
Right 1003600676 6:7514336-7514358 GTAAAGAATGGTTCTGTCTGAGG No data
1003600673_1003600680 25 Left 1003600673 6:7514308-7514330 CCTTGTGCTGAGACTGCTGTTGG No data
Right 1003600680 6:7514356-7514378 AGGTAGGGATCAGTTAAGGTAGG No data
1003600673_1003600675 -7 Left 1003600673 6:7514308-7514330 CCTTGTGCTGAGACTGCTGTTGG No data
Right 1003600675 6:7514324-7514346 CTGTTGGATTCAGTAAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003600673 Original CRISPR CCAACAGCAGTCTCAGCACA AGG (reversed) Intergenic
No off target data available for this crispr