ID: 1003600675

View in Genome Browser
Species Human (GRCh38)
Location 6:7514324-7514346
Sequence CTGTTGGATTCAGTAAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003600671_1003600675 8 Left 1003600671 6:7514293-7514315 CCAGTGTTCCAGATGCCTTGTGC No data
Right 1003600675 6:7514324-7514346 CTGTTGGATTCAGTAAAGAATGG No data
1003600672_1003600675 0 Left 1003600672 6:7514301-7514323 CCAGATGCCTTGTGCTGAGACTG No data
Right 1003600675 6:7514324-7514346 CTGTTGGATTCAGTAAAGAATGG No data
1003600673_1003600675 -7 Left 1003600673 6:7514308-7514330 CCTTGTGCTGAGACTGCTGTTGG No data
Right 1003600675 6:7514324-7514346 CTGTTGGATTCAGTAAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003600675 Original CRISPR CTGTTGGATTCAGTAAAGAA TGG Intergenic
No off target data available for this crispr