ID: 1003603665

View in Genome Browser
Species Human (GRCh38)
Location 6:7541478-7541500
Sequence CGCGGGCGGCGGGCGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 419}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003603648_1003603665 19 Left 1003603648 6:7541436-7541458 CCCGCCCGGTGTTACTCAGGCCT 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 419
1003603645_1003603665 23 Left 1003603645 6:7541432-7541454 CCGCCCCGCCCGGTGTTACTCAG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 419
1003603651_1003603665 15 Left 1003603651 6:7541440-7541462 CCCGGTGTTACTCAGGCCTCGGT 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 419
1003603657_1003603665 -1 Left 1003603657 6:7541456-7541478 CCTCGGTGGCGCAGGGCGGAGTC 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 419
1003603642_1003603665 26 Left 1003603642 6:7541429-7541451 CCCCCGCCCCGCCCGGTGTTACT 0: 1
1: 0
2: 2
3: 12
4: 90
Right 1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 419
1003603649_1003603665 18 Left 1003603649 6:7541437-7541459 CCGCCCGGTGTTACTCAGGCCTC 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 419
1003603641_1003603665 29 Left 1003603641 6:7541426-7541448 CCGCCCCCGCCCCGCCCGGTGTT 0: 1
1: 0
2: 8
3: 60
4: 560
Right 1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 419
1003603643_1003603665 25 Left 1003603643 6:7541430-7541452 CCCCGCCCCGCCCGGTGTTACTC 0: 1
1: 0
2: 0
3: 9
4: 175
Right 1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 419
1003603652_1003603665 14 Left 1003603652 6:7541441-7541463 CCGGTGTTACTCAGGCCTCGGTG 0: 1
1: 0
2: 1
3: 4
4: 105
Right 1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 419
1003603640_1003603665 30 Left 1003603640 6:7541425-7541447 CCCGCCCCCGCCCCGCCCGGTGT 0: 1
1: 0
2: 8
3: 92
4: 741
Right 1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 419
1003603644_1003603665 24 Left 1003603644 6:7541431-7541453 CCCGCCCCGCCCGGTGTTACTCA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 419
1003603647_1003603665 20 Left 1003603647 6:7541435-7541457 CCCCGCCCGGTGTTACTCAGGCC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003603665 Original CRISPR CGCGGGCGGCGGGCGCAGGT GGG Intergenic
900413912 1:2526418-2526440 CGCGGGCTGCGGGGGCGGGCGGG - Intronic
900593330 1:3469324-3469346 CCCGGGTGGCAGGGGCAGGTGGG - Intronic
900786947 1:4655290-4655312 CGCGGCCGGCGGGCGGCGGGAGG + Exonic
901007702 1:6179851-6179873 CGCGGGCGGCGGGGGCGGCGCGG - Intronic
901019721 1:6249580-6249602 CGGGGGCGGCGGGCGCAGCGGGG + Exonic
901066598 1:6497342-6497364 CGCGGGGGGCGGGCGGCGGGCGG + Intronic
901109546 1:6784668-6784690 CACAGGAGGCGGGCGCAGGCGGG + Intergenic
901551128 1:9997147-9997169 CGCGCGCGGGAGGAGCAGGTGGG - Intergenic
901676580 1:10889031-10889053 GGCGGGCTGCGGGCGCAGCAGGG + Intergenic
902985120 1:20150181-20150203 CGCGGGGGAGGGGCGCAGCTGGG - Exonic
903349950 1:22711327-22711349 CGGGGGCGGCGAGCGCGCGTGGG - Intronic
903828648 1:26161960-26161982 CGCGGGCGGCGGCGGCGGCTCGG + Exonic
904500157 1:30908601-30908623 CGCGGGCGGCGGGCGGCGGGCGG + Exonic
904672984 1:32179949-32179971 CGCGCGCGGGGGGCGCACGTGGG + Intronic
904837736 1:33349853-33349875 CGCGCGCGGCGGGCGCTCGAGGG + Intronic
905890575 1:41516236-41516258 AGCGCGCGGCGGGCGCCGCTGGG + Intronic
906078412 1:43068405-43068427 CGGGGGCGGCGGGGGCGGGCTGG + Intergenic
906130754 1:43453838-43453860 GGCGGGCGGCGGGCGGCGGGCGG + Exonic
906130757 1:43453845-43453867 GGCGGGCGGCGGGCGGCGGGCGG + Exonic
906130762 1:43453852-43453874 GGCGGGCGGCGGGCGGGGGCGGG + Exonic
906322063 1:44823069-44823091 CTCTGGCGGCGGGCCCAGGATGG + Exonic
906805645 1:48776838-48776860 CGCCGGGGGCGGGCCCCGGTCGG + Exonic
908669728 1:66533251-66533273 CCCGGACGGCGAGCCCAGGTTGG + Intergenic
912353990 1:109041115-109041137 CGGGGGCGGGGGGCGAGGGTAGG - Intronic
912518391 1:110229761-110229783 CGGGAGCGGCAGGAGCAGGTGGG - Intronic
912993482 1:114511104-114511126 CGCGGGCGGCGGGCGGCGCGGGG - Exonic
913450121 1:118987548-118987570 CGCGGGAGGCGGGCGGAGAGGGG - Intronic
914803163 1:150974762-150974784 CGCCGGCGGCTGGCGGAGGAGGG - Exonic
915348337 1:155209179-155209201 GGCGGGGGGCGGGCCCAGGCAGG + Exonic
915740201 1:158113448-158113470 CGCGGGCGGCGGGTGGGGGCGGG + Intergenic
916107209 1:161441002-161441024 GGCGGGCGGCGGGCGGCGGGTGG - Intergenic
916108796 1:161448420-161448442 GGCGGGCGGCGGGCGGCGGGTGG - Intergenic
916109073 1:161449450-161449472 GGTGGGCGGTGGGCGCAGGCCGG - Intergenic
916110384 1:161455801-161455823 GGCGGGCGGCGGGCGGCGGGTGG - Intergenic
916111969 1:161463211-161463233 GGCGGGCGGCGGGCGGCGGGTGG - Intergenic
916112246 1:161464241-161464263 GGTGGGCGGTGGGCGCAGGCCGG - Intergenic
916113556 1:161470592-161470614 GGCGGGCGGCGGGCGGCGGGTGG - Intergenic
916113833 1:161471622-161471644 GGTGGGCGGTGGGCGCAGGCCGG - Intergenic
917413429 1:174783437-174783459 TACGGGCGGCGGGGGCAGGGTGG - Intronic
918265673 1:182839549-182839571 CGCGGGCGGCGGCGGCGGCTGGG + Intronic
919920854 1:202165729-202165751 CGGGGGCGGCGGGCGGGGGAAGG - Intergenic
920912676 1:210233029-210233051 CGCGGGCCGCGGGGGCGGGAGGG + Intronic
921556142 1:216601080-216601102 CGCGGGCGGCAGCAGCGGGTTGG + Intronic
921930238 1:220748673-220748695 CGCCGGCGGCTGCAGCAGGTGGG + Exonic
922134837 1:222814902-222814924 CGCCGGCGGCGGGCGACGGGCGG - Intergenic
923505235 1:234600034-234600056 CGCGGGCGGGGGGCGCGAGGAGG + Intergenic
1063592639 10:7408550-7408572 CGGGGCTGGCGGGGGCAGGTGGG - Intronic
1065550013 10:26860712-26860734 GGCGGCCGGCGGGCGCTGGCCGG - Intronic
1066370299 10:34814509-34814531 AGCGCGCGGGGGGCGCAGGCCGG - Intronic
1066429368 10:35336956-35336978 CGCGGGCGGCGGGGGCGTGTGGG - Exonic
1066746029 10:38604678-38604700 GGCGGGGTGCGTGCGCAGGTGGG - Intergenic
1067091220 10:43266683-43266705 CGCGGGCTCCGGGCGCGGGGCGG - Intronic
1071573786 10:86711679-86711701 CGAGGGCGGCGTTCGCAGGCCGG + Intronic
1072757743 10:98031477-98031499 CGCAGGCGGCAGGAGCGGGTGGG - Intergenic
1073139127 10:101236279-101236301 GGGGGGCGCCGGGCGCAGGCCGG + Intergenic
1073432132 10:103493781-103493803 CGGGGGCGGCGGTCGCAGGAGGG + Intergenic
1073461601 10:103668765-103668787 CGCGGGCGGAAGGCGGAGGAGGG + Intronic
1074169605 10:110919555-110919577 GGCGGGCGGGGGGCGGCGGTTGG + Exonic
1075616133 10:123891862-123891884 GGCGCGGGGCGGGCGCAGGGGGG + Intronic
1075801852 10:125159416-125159438 GCCGGGCGGCGGGCGCGGGCGGG - Intronic
1076719833 10:132388197-132388219 CGCGGGCGGGGGGCTCATGCGGG + Intergenic
1076719849 10:132388236-132388258 CGCGGGCGGGGGGCTCATGCGGG + Intergenic
1076719892 10:132388332-132388354 CGCGGGCGGGGGGCTCATGCGGG + Intergenic
1076719987 10:132388540-132388562 CGCGGGCGGGGGGCTCATGCGGG + Intergenic
1076936128 10:133568281-133568303 CCGGGGCGGCGGGCTCAGGCTGG - Intronic
1077052904 11:575847-575869 CGCGCGCGGCGGGAGCACCTGGG - Intergenic
1077285603 11:1763977-1763999 CGCGGCCGGCGTGCGCGGGGCGG + Exonic
1077386019 11:2269864-2269886 CCCGGGCCGCGGGGGCAGCTCGG - Exonic
1077664404 11:4094811-4094833 CACGGGTGGCGGGCGCGGGAAGG + Exonic
1078174969 11:8963817-8963839 GGCTGGCGGAGGGCGCAGGTGGG + Intronic
1078771819 11:14358786-14358808 CGGGGGCGGCGTGGGCAAGTCGG - Exonic
1081672712 11:44950610-44950632 CGCAGGCGGCGGGCGGCGGGAGG + Intronic
1081854584 11:46295568-46295590 CGCGGGCCGTCGGCGCAGGCCGG + Intronic
1082979537 11:59106985-59107007 AGCGCGCAGCGCGCGCAGGTGGG - Intergenic
1083258258 11:61509591-61509613 CGCGCGCAGCGGGTGCAGGTCGG - Exonic
1083648460 11:64186419-64186441 CGCGGGCGGCGGGCGGGAGCGGG + Intronic
1083899806 11:65638149-65638171 CGCGGGCGGCGGCGGCTGGGCGG + Intronic
1083941650 11:65899514-65899536 GGCGGGCAGCGGGCGCCGTTAGG + Intronic
1084010868 11:66347680-66347702 GGCGGGCGGCGGGCGGCGGGCGG - Exonic
1084010871 11:66347687-66347709 GGCGGGCGGCGGGCGGCGGGCGG - Exonic
1084010874 11:66347694-66347716 GGCGGGCGGCGGGCGGCGGGCGG - Intergenic
1084480356 11:69416250-69416272 GGCAGGCGGCGTGTGCAGGTTGG + Intergenic
1085266790 11:75242125-75242147 CGCGGGCGCGCGGCGCGGGTCGG - Exonic
1085561142 11:77473762-77473784 CGCGGGCGGGGGGGGAAGGGGGG + Exonic
1086337183 11:85811319-85811341 CGGGGGCGGAGGGCGAAGGGAGG - Intergenic
1088579038 11:111298996-111299018 CGCGGGCAGCGGGCGCCCCTCGG - Intronic
1089262423 11:117232197-117232219 CGCGGGCGGCCTACGCAGGCAGG + Exonic
1089740320 11:120577786-120577808 TGCTGGCGGCAGGGGCAGGTGGG + Intronic
1090636692 11:128694297-128694319 CGCGGGCGGCGGGGACCGGCCGG + Intronic
1090699284 11:129279547-129279569 GGCGGGCGGCGGGCTCCGGCGGG - Intergenic
1091550262 12:1530902-1530924 CGCGGGCTCCGGGCGCCGCTCGG - Intronic
1092286411 12:7131338-7131360 TGCGGGCAGAGGGCTCAGGTAGG + Intronic
1095958490 12:47819607-47819629 CGCGGTCGGGGGGCGCAAGCCGG + Intronic
1096178650 12:49538999-49539021 TGCAGGCGGCGGGCGCGGGAGGG + Intergenic
1096220980 12:49828076-49828098 CGCGGGGGGCGGGAGGGGGTGGG + Intronic
1096251089 12:50033034-50033056 CGCGGGCGTCGGGGGCAGGGAGG + Intronic
1096461141 12:51821862-51821884 CGGGGGCGGCGGGGGCAGCGCGG + Intergenic
1096841151 12:54379774-54379796 GGCAGGTGGCGGGCGCGGGTAGG - Intronic
1096876139 12:54631907-54631929 GGTGGGGGGCGGGTGCAGGTGGG - Intronic
1100869404 12:98894891-98894913 CGCGGGGGGCGGGGGCAGTGGGG - Intronic
1102197123 12:111033907-111033929 CGCGGGCGGAGCGCGCCGGGCGG - Intergenic
1102459874 12:113093602-113093624 CACGGGCGGCGGGTGCAGGATGG - Exonic
1102676828 12:114665089-114665111 CCCGCGCGGCGGGCCCAGGAAGG - Intergenic
1103381269 12:120496049-120496071 CGGGGCCGGCGGGAGCAGGGCGG + Intronic
1103432900 12:120903723-120903745 CGTGGGGGGGGGGCGCGGGTTGG - Intronic
1103488192 12:121296736-121296758 CCCGGGCGGCGGGCGCGCGGGGG + Intronic
1103527831 12:121579486-121579508 GGCGGGCGGCGGGGGCGGCTGGG - Intronic
1103547546 12:121712815-121712837 CGCGGGCGTGGGGCGCTGGGGGG + Exonic
1103698544 12:122835647-122835669 AGCGGGCGGCGGGCGGCGGGCGG + Intronic
1103698547 12:122835654-122835676 GGCGGGCGGCGGGCGGCGGGCGG + Intronic
1103698550 12:122835661-122835683 GGCGGGCGGCGGGCGGCGGCGGG + Intronic
1104930965 12:132339297-132339319 CGCCGGAGGCTGGCCCAGGTGGG - Intergenic
1105472152 13:20703930-20703952 CACGGGCGCGGGGCGCAGGCGGG + Intronic
1106248726 13:27968556-27968578 CGGTGGCGGCGGGCCCAGGAGGG + Exonic
1106568435 13:30906402-30906424 CGCGCGCGGCTGACGCAGGCAGG + Exonic
1107604048 13:42040856-42040878 GGCGGCCGGCGGGCGCGGGCTGG + Intronic
1110064556 13:71087509-71087531 CGCGGGCGGGGGGGGGGGGTGGG - Intergenic
1110775663 13:79405851-79405873 CGCGGGCGGCGCGCGGAGGAGGG - Exonic
1112505477 13:99972078-99972100 CGCGGGCAGAGGGCGCGGGGTGG + Intergenic
1113787579 13:113010624-113010646 CGCGGGCAGAGGCAGCAGGTGGG - Intronic
1113809545 13:113129977-113129999 CGCGGGCTGCGGGCGTGGGAGGG - Intronic
1114610377 14:24036336-24036358 GGCGGGCGGCGGGCGGCGGGAGG + Intergenic
1116657979 14:47675013-47675035 GGCCGGCGGCGGGCGCGGGCAGG + Intergenic
1117723164 14:58646561-58646583 CGCGGGCGGGGGCCACAGGGCGG + Exonic
1117912586 14:60649251-60649273 AGGGGGCGGCGGCCGCAGGGAGG + Exonic
1118932381 14:70254945-70254967 GGCGGGCGGCGGGCGGCGGGCGG - Intergenic
1118932384 14:70254952-70254974 GGCGGGCGGCGGGCGGCGGGCGG - Intergenic
1118932387 14:70254959-70254981 GGCGGGCGGCGGGCGGCGGGCGG - Intergenic
1118932390 14:70254966-70254988 GGCGGGCGGCGGGCGGCGGGCGG - Intergenic
1118932393 14:70254973-70254995 GGCGGGCGGCGGGCGGCGGGCGG - Intergenic
1118932396 14:70254980-70255002 GGCGGGCGGCGGGCGGCGGGCGG - Intergenic
1118932399 14:70254987-70255009 GGCGGGCGGCGGGCGGCGGGCGG - Intergenic
1118932402 14:70254994-70255016 GGCGGGCGGCGGGCGGCGGGCGG - Intergenic
1118932405 14:70255001-70255023 GGCGGGCGGCGGGCGGCGGGCGG - Intergenic
1120167876 14:81220304-81220326 GCCGGGCGGCGGGCGCGGGGGGG - Intronic
1122108657 14:99480495-99480517 CGGGGTCGGAGGGCGCCGGTCGG - Intronic
1122543372 14:102509716-102509738 CGCCGGCGGCGGGCGGCGGGCGG + Exonic
1122543376 14:102509723-102509745 GGCGGGCGGCGGGCGGCGGGCGG + Exonic
1122543379 14:102509730-102509752 GGCGGGCGGCGGGCGGCGGGCGG + Exonic
1122582079 14:102777383-102777405 CGCGGGCGGCGGGGGCGGGGCGG + Intergenic
1122626046 14:103085810-103085832 CTCTGGCGGCGGGCTCAGGCAGG + Intergenic
1122736915 14:103848267-103848289 CGAGGGATGCTGGCGCAGGTGGG - Intergenic
1123035497 14:105470224-105470246 GGCGGGGGGCGGCCGCAGGTGGG - Exonic
1123493965 15:20804820-20804842 CGTGGGCGGCGGCTGCAGGTAGG + Intergenic
1123550464 15:21373902-21373924 CGTGGGCGGCGGCTGCAGGTAGG + Intergenic
1125181006 15:36880734-36880756 CCCGGGCGGAGGGAACAGGTGGG + Intergenic
1125485604 15:40108812-40108834 CGGCGGCGGCGGGCACAGGCCGG + Exonic
1125541178 15:40471011-40471033 GGCGGGCGGCGGGCGCGGCGAGG - Exonic
1126668425 15:51094703-51094725 CGCGGGCGGCGCGGGCTGGGCGG + Intronic
1126668455 15:51094810-51094832 CGCGCGAGGCGAGCGCAGGGCGG + Intronic
1126736702 15:51737807-51737829 CGCGGGCGCCCGGGGCAGGCAGG - Exonic
1127606182 15:60591291-60591313 AGCGGGCGGCGGGCGGCGGGCGG + Intronic
1128264275 15:66253600-66253622 GGCCGGCCGCGGGAGCAGGTAGG - Exonic
1129986460 15:79923496-79923518 CGCGGGCGGCGGAGGCAGCGGGG - Exonic
1131119714 15:89814731-89814753 CGGGGGCTGCGGGCGCGGGTAGG - Intronic
1131257620 15:90872209-90872231 CGCCGGCGGCCGGCGCAGGTAGG + Intronic
1131466048 15:92655584-92655606 CGCGGGCGGCGGGAGCGGCCAGG + Exonic
1131517614 15:93089323-93089345 CGCGGGCGGGGGGCGCGCGCGGG + Intergenic
1132326368 15:100973581-100973603 ACCGGGCGGCGAGCGCAGCTCGG - Intronic
1202958807 15_KI270727v1_random:101156-101178 CGTGGGCGGCGGCTGCAGGTAGG + Intergenic
1132684724 16:1157565-1157587 CCGGGGAGGCGGGCGCAGGCGGG - Intronic
1132719682 16:1309611-1309633 CGCGGGCGGGGCGCGCGGGGCGG - Intronic
1132720592 16:1313801-1313823 ACCGGGAGGCGGGGGCAGGTAGG - Intronic
1132889330 16:2196308-2196330 CGGGGGCGCGGGGCGCGGGTGGG - Intronic
1132889454 16:2196654-2196676 GGCGCGCGGCGGGCGCGGGGCGG + Intergenic
1132893273 16:2214905-2214927 CGCGGGAGGCGGGGGCGGATTGG - Intergenic
1133029675 16:3004434-3004456 CGCGGGCAGCGGTGGCAGCTCGG - Intergenic
1133271904 16:4614488-4614510 GGCTCGCGGCGGGCGGAGGTGGG - Intronic
1133333104 16:4988317-4988339 GGTGGGTGCCGGGCGCAGGTGGG - Intronic
1133732652 16:8590029-8590051 AGCGGGGGGCGCGTGCAGGTCGG - Intergenic
1134070176 16:11255830-11255852 AGCAGGCGGCGGGCGCGGGGCGG - Intronic
1135342901 16:21664175-21664197 GGCGGGCGGGTGGCGCAGGGCGG - Intergenic
1136129746 16:28212054-28212076 AGCGGGCGGAGGGCGGAGGGCGG + Intergenic
1136399758 16:30010932-30010954 GGGGGACGGCGGGCGCAGGCTGG + Exonic
1136737033 16:32474966-32474988 GGCGGGGTGCGTGCGCAGGTGGG + Intergenic
1138611606 16:58129423-58129445 CCCGGGGGGCGGGCTCAGATGGG - Exonic
1139529797 16:67537537-67537559 CGCGGGGGGCGAGCGCGGGTCGG + Intronic
1139917884 16:70439248-70439270 CGCGTGCGGGGGGCGGAGGGAGG - Intergenic
1140280160 16:73546494-73546516 GGCGGGGGGCGGGGGCGGGTAGG + Intergenic
1140927807 16:79600078-79600100 CGCGGGGGGCGCGGGCAGGGCGG - Exonic
1141054597 16:80803960-80803982 GGCGGGCGGCGGGCGGCGGGCGG + Intronic
1141054750 16:80804559-80804581 GGCCGGCGGCGGGCGCCGGGCGG - Intergenic
1141585042 16:85028032-85028054 CGCGGGCCGAGGGCTCAGGCCGG + Intronic
1141760992 16:86028671-86028693 CTCGGGAGGCGGGGGCAGGAAGG - Intergenic
1142136324 16:88453492-88453514 CGCGGGCTGGGGGCGCGGGCCGG + Exonic
1142156233 16:88533929-88533951 CGCGGGCGGCCGGGGCAGCGAGG + Exonic
1142265681 16:89063076-89063098 CGCCGGCGGTGGGGGCAGGTGGG - Intergenic
1142299206 16:89247051-89247073 CGAGGGCGGCCCGCGCCGGTTGG - Intergenic
1203016038 16_KI270728v1_random:354611-354633 GGCGGGGTGCGTGCGCAGGTGGG - Intergenic
1203034373 16_KI270728v1_random:627769-627791 GGCGGGGTGCGTGCGCAGGTGGG - Intergenic
1142676527 17:1516855-1516877 TGCGGACGGCGGGCGCGGGCTGG - Exonic
1143247816 17:5500830-5500852 CGCTGCCCGCGGGCCCAGGTCGG - Intronic
1143627892 17:8121592-8121614 AGCGGGCGGCGGGGGCAGCGGGG + Exonic
1146256012 17:31391855-31391877 GGCGGGCGGCGCGGGCTGGTCGG + Exonic
1147162973 17:38578693-38578715 CGGGGGCGGCGGGGGCAGCGGGG - Exonic
1147705734 17:42423461-42423483 CGCTGGCGGCGGGAGCGGGACGG + Exonic
1148323644 17:46771493-46771515 CGGGGGCGGCGGGGGCGGGGCGG + Intronic
1148438283 17:47698683-47698705 GGCTGGCGGTGGGCTCAGGTTGG - Exonic
1150791918 17:68205816-68205838 CGCGAGCAGCAGGGGCAGGTGGG + Intergenic
1151293329 17:73165732-73165754 GGCAGGCGGCGGGCGCAGAGCGG + Intronic
1151491032 17:74432444-74432466 GGCGGGGGGCGGGCGGGGGTGGG - Intronic
1151812641 17:76453332-76453354 CGCGGGGGGCGGGGGCAGGATGG + Exonic
1152134291 17:78494822-78494844 TGCGGGCAGTGGGCACAGGTGGG + Intronic
1153051989 18:908420-908442 CGCGCGGGGCGGGCGGCGGTGGG + Intronic
1156171843 18:34494365-34494387 GGGGGGCGGCGGGGGCGGGTGGG + Intronic
1157279080 18:46334133-46334155 CGCGGGGCGCGGGCGGCGGTGGG - Intronic
1157590442 18:48833473-48833495 GGAGGGCGGCGGGGGCAGGGGGG - Intronic
1160163328 18:76491551-76491573 GGCGGGGGGCGGGCGCCGGGGGG + Intronic
1160543303 18:79637595-79637617 CGCGGGAGGAGGGCGGAGCTGGG - Intergenic
1160691205 19:461292-461314 CTTGGGCGGCGGGCGGGGGTGGG - Intergenic
1160790041 19:918982-919004 AGCGGGGGGCGGGCGCATGTGGG + Intronic
1160873053 19:1285765-1285787 GGCAGGGGGCGGGCGCAGGCTGG + Intergenic
1160927700 19:1555027-1555049 CGCGGCCGGAGGGGGCAGGGGGG - Exonic
1160947807 19:1651822-1651844 CGCGCGCTGCAGGCGCTGGTCGG - Intronic
1160967711 19:1753863-1753885 CGCGGGCGGCGCGGGCAGCGCGG + Exonic
1161108779 19:2456969-2456991 GGCGGGCGGCGGGCGCGGCGCGG - Exonic
1161203649 19:3029231-3029253 CGCGGGCGGCGGGCCCCGCGCGG + Intronic
1161333825 19:3700430-3700452 CGGCGGCGGCGGTCGCAGCTCGG - Exonic
1161456232 19:4370978-4371000 TGCAGGTGGCGGGTGCAGGTGGG - Intronic
1161849742 19:6732159-6732181 CGCAGGCGGCGGGGGTGGGTGGG + Intronic
1162486057 19:10961183-10961205 CGCGGGCCGCGGGGGCAGCGCGG + Intronic
1162954678 19:14091273-14091295 CGGGGGCGGCGGCAGCAGGAGGG - Intergenic
1163490827 19:17616375-17616397 CGCGGGCGGCGGGCGGGAGGCGG + Intronic
1164693242 19:30226145-30226167 CGCGGGTGGGGGGCGCCGGCCGG - Intergenic
1165040236 19:33063806-33063828 GGCGGGCGGCGGGCGGCGGGTGG - Intronic
1165040239 19:33063813-33063835 GGCGGGCGGCGGGCGGCGGGCGG - Intronic
1165213696 19:34254623-34254645 CGGGCGCGGCGGGCGCAGGCGGG + Intronic
1165233848 19:34404798-34404820 CACCGGCGGTGCGCGCAGGTAGG + Exonic
1165311246 19:35030576-35030598 CGCGGGCGGCGGCCGCTGCTCGG - Intergenic
1165420199 19:35718453-35718475 CGGGGGCGGCGTGGGCAGGCCGG + Intronic
1165479499 19:36054294-36054316 GGCAGGCGGCGAGCGCGGGTGGG - Exonic
1165816848 19:38647808-38647830 CGCTGGCGGCGGGGGCAGCATGG + Exonic
1165928699 19:39342688-39342710 CGCGGGCGGCGGCGGCGGGCGGG + Intronic
1166112214 19:40629571-40629593 CCCGAGTGGCGGGCGCGGGTGGG - Exonic
1166721798 19:45001420-45001442 GGCGGGCGGCGGGCGGGGGCGGG - Exonic
1167103842 19:47419327-47419349 CGGGGGCAGCAGGCGCAGGCGGG + Intronic
1167260710 19:48456197-48456219 CGTGGGCTGGGGGGGCAGGTGGG - Exonic
1167377205 19:49118639-49118661 CGAGGGCGGAGGGCGGAGGCAGG + Exonic
1167473544 19:49688092-49688114 GGCGGGGGGCGGGTGCAGGCAGG - Intronic
927751420 2:25673594-25673616 CGAGGGCGGAGGGCGGAGGGCGG + Exonic
927881500 2:26692830-26692852 CGCGGGCCGGGGGCGCCGGGGGG + Exonic
930656569 2:54013153-54013175 GGCGGGGGGTGGGGGCAGGTGGG - Intronic
932496702 2:72149091-72149113 TGCGGGCGGCGGGCGGCGGGCGG - Intergenic
932757857 2:74421425-74421447 CGCGGTGGGCGGGAGCAAGTAGG + Intronic
933278218 2:80304610-80304632 TGCGGGCGGCGGGCGGCGGGCGG + Exonic
933278221 2:80304617-80304639 GGCGGGCGGCGGGCGGCGGGCGG + Exonic
934308436 2:91843870-91843892 GGCGGGGTGCGTGCGCAGGTGGG - Intergenic
934763509 2:96868732-96868754 CGCAGGCGACGGGGGGAGGTAGG + Intronic
934916283 2:98303256-98303278 CGGGGGCGGGGGGTGGAGGTGGG + Intronic
934993181 2:98935852-98935874 CGGGGGCACCGGGCGGAGGTGGG - Intronic
935112457 2:100105238-100105260 CGCGGGCGGCGGACCCGGGTGGG + Intronic
935591884 2:104852530-104852552 TGGGGGCGGCGGGCGCAAGCGGG + Intergenic
936038400 2:109129987-109130009 CGCGGGCGGCGGGGGCGGCGCGG + Exonic
937956135 2:127422719-127422741 CGCGGGCGGGTGGCGCTGGAGGG + Intronic
938038138 2:128053515-128053537 CGGCGGCGGCGGGGGCGGGTAGG - Intergenic
942565960 2:177264797-177264819 CGCGGCCGGCGGGGGAAGGAAGG - Exonic
945188851 2:207166269-207166291 CCCTGGCGGCGGGCGCGGATTGG + Intronic
945225847 2:207530393-207530415 GGCGGGCGGCGGGCGGCGGGCGG + Intronic
946313834 2:218897141-218897163 CGCGGGCGGCGAGAAAAGGTGGG - Intronic
947542888 2:230990875-230990897 CGAGCGCGGCGGGCGGACGTCGG - Intergenic
947741752 2:232487903-232487925 CGCGCGGGGCGGGCGGAGGAGGG - Intergenic
947984813 2:234438870-234438892 TGCGGGGGGCGGGGGCAGGCGGG + Intergenic
948824687 2:240568518-240568540 CGCGGGCGAGGGGCGCCGGGCGG - Intronic
948897161 2:240932891-240932913 CGGTGGCGGCGGGAACAGGTGGG + Intronic
948953882 2:241272594-241272616 CGCGGGCGGGGGCCGCAGCCTGG + Intronic
949014519 2:241701999-241702021 CGCGGGAGGCGGGGGCGGGGCGG - Intergenic
1168804322 20:663595-663617 AGGGCGCTGCGGGCGCAGGTAGG + Exonic
1171173582 20:23035402-23035424 CTCGGGCGGCGGGCCCAGGGCGG - Exonic
1171346435 20:24469567-24469589 CGCAGGCGGAGAGCGCAGGGCGG + Exonic
1172118435 20:32584540-32584562 CGCGCGCGGCGGCCGCGGGCGGG - Intronic
1172118637 20:32585218-32585240 CGCGGGCGGCCGGGGGAGGCGGG + Intronic
1173165964 20:40687715-40687737 CGCGGGCCGCGGGCGACGGGCGG - Exonic
1173221858 20:41137875-41137897 CGCGCGGGGCGGGCCCAGGCAGG - Intronic
1174804314 20:53593337-53593359 CGCGGGCGGAGGGGGAACGTCGG - Intronic
1175074048 20:56358949-56358971 CCCGGGAGGCGGGCGGAGGCCGG - Exonic
1175340927 20:58228576-58228598 CGCGGGCGGCGGGGCCAACTGGG - Exonic
1175715486 20:61252353-61252375 CGAGCGCGGCGGGCGCAGCGGGG + Intergenic
1175809167 20:61848297-61848319 CGTGGGTGGCTGGGGCAGGTGGG - Intronic
1175994116 20:62804780-62804802 CGCGGGGGGCGGGCGGGGGGAGG - Intergenic
1176005796 20:62861706-62861728 CGCGGGCGGCGGGCGGCGGGAGG + Exonic
1176139361 20:63538275-63538297 GGCGGCCGTCGGGTGCAGGTGGG - Intergenic
1176173676 20:63707862-63707884 AGGGCGCGGCGGACGCAGGTAGG - Exonic
1176194565 20:63831284-63831306 CGCGGGCGGCGGGGGCCGCGGGG - Intergenic
1176444658 21:6810947-6810969 CGTGGGCGGCGGCTGCAGGTAGG - Intergenic
1176547902 21:8209306-8209328 CCCGGCCGCCGGGCGCGGGTCGG + Intergenic
1176555798 21:8253519-8253541 CCCGGCCGCCGGGCGCGGGTCGG + Intergenic
1176566835 21:8392339-8392361 CCCGGCCGCCGGGCGCGGGTCGG + Intergenic
1176574735 21:8436553-8436575 CCCGGCCGCCGGGCGCGGGTCGG + Intergenic
1176611349 21:8987846-8987868 CCCGGCCGCCGGGCGCGGGTCGG + Intergenic
1176733666 21:10522449-10522471 CGCGGGCGGAGGGGGGACGTCGG + Intronic
1176822824 21:13675985-13676007 CGTGGGCGGCGGCTGCAGGTAGG - Intergenic
1176952654 21:15064903-15064925 CGCGGGTGGCGGGCGGGCGTGGG + Exonic
1177157374 21:17513093-17513115 CGTGGGCGGCGGCTGCAGGTAGG - Exonic
1179209363 21:39312972-39312994 GGCGGGCGGCGGGCGGCGGGCGG + Intronic
1179610662 21:42547984-42548006 CGCGGGCGACGGGCCCAGCAGGG - Intronic
1179674902 21:42974734-42974756 GGCGGGCGGCGGCCGCGGGCCGG - Intronic
1179810178 21:43865169-43865191 CGAGGGCGGAGGGCGGAGGGCGG + Intronic
1180535521 22:16390950-16390972 GGCGGGGTGCGTGCGCAGGTGGG - Intergenic
1180558971 22:16601137-16601159 CGCGGGCGCCCGGCGCAGCCCGG - Intergenic
1180560234 22:16609760-16609782 CGCGGGCGGAGGGGGGACGTCGG - Intergenic
1180762316 22:18219928-18219950 CGCAGGAGGCGGGCGGAGGCCGG + Intergenic
1180773351 22:18404680-18404702 CGCAGGAGGCGGGCGGAGGCCGG - Intergenic
1180804704 22:18654229-18654251 CGCAGGAGGCGGGCGGAGGCCGG - Intergenic
1180806042 22:18715181-18715203 CGCAGGAGGCGGGCGGAGGCCGG + Intergenic
1180871767 22:19150506-19150528 CTTGAGCGGCGGGCGCGGGTGGG - Intergenic
1180908364 22:19431572-19431594 GGCGGGCGGCGGCCGGAGGGCGG - Exonic
1181192447 22:21151613-21151635 CGCAGGAGGCGGGCGGAGGCCGG - Intergenic
1181216992 22:21340962-21340984 CGCAGGAGGCGGGCGGAGGCCGG + Intergenic
1181457961 22:23070357-23070379 GGCGGGCGGCGGGCGGCGGGCGG + Exonic
1182236869 22:28883351-28883373 CGCGGGCGGGGGGCGGAGCTGGG + Intergenic
1182237140 22:28884249-28884271 CGCGGGGGGCGAGCGCACGTGGG + Intronic
1182435444 22:30326882-30326904 CTCAGGCGGCGGGCGCGGCTGGG - Exonic
1182686193 22:32122894-32122916 CTCAGGGGGCGGGGGCAGGTTGG + Intergenic
1182804396 22:33058142-33058164 CGCGGGATGCGGGCGCACGGAGG - Intronic
1183299468 22:37051814-37051836 CGCAGGCGGCTGGGGCAAGTGGG + Exonic
1183343373 22:37294205-37294227 GGCGGGCGGGGGGTGCAGGCAGG + Intronic
1183535336 22:38398011-38398033 CGCGGGCGGAGGGGGGACGTTGG - Intronic
1183642640 22:39101600-39101622 GGCGGGGGGCGGGGGCGGGTTGG + Intronic
1183642670 22:39101662-39101684 GGCGGGGGGCGGGGGCGGGTTGG + Intronic
1183740165 22:39664684-39664706 CGCGGGAGGGGCGGGCAGGTGGG - Intronic
1184645251 22:45891720-45891742 CGCGGGGCGCGGGCGCGTGTGGG - Intergenic
1184796951 22:46738229-46738251 CCCGGGCGGCGGGCGGCGGGCGG + Exonic
1184796955 22:46738236-46738258 GGCGGGCGGCGGGCGGCGGGAGG + Exonic
1185281682 22:49972424-49972446 TAGGGGCGGCGGGCCCAGGTGGG - Intergenic
1185285834 22:49999625-49999647 CGGGGGCGGGGCGCGGAGGTGGG + Intronic
1185285854 22:49999665-49999687 CGGGGGCGGGGCGCGGAGGTGGG + Intronic
1185321383 22:50201600-50201622 GGCGGGCGAGGGGCGCGGGTGGG + Intronic
1185337155 22:50275854-50275876 CCCCGGGGGCGGGGGCAGGTGGG - Intronic
1185420242 22:50730891-50730913 CGGGCGCGGGGGGCGCAGGGCGG + Intergenic
1203235181 22_KI270731v1_random:145662-145684 CGCAGGAGGCGGGCGGAGGCCGG - Intergenic
1203252783 22_KI270733v1_random:125604-125626 CCCGGCCGCCGGGCGCGGGTCGG + Intergenic
1203255540 22_KI270733v1_random:135688-135710 CGCGGGTGGCGGGCGGCGGGCGG + Intergenic
1203260839 22_KI270733v1_random:170690-170712 CCCGGCCGCCGGGCGCGGGTCGG + Intergenic
949577782 3:5355589-5355611 GGCGGGGGGCGGGGGGAGGTGGG + Intergenic
952287214 3:31980960-31980982 CGGGGGAGGCGGCCGCAGGAGGG - Exonic
952744489 3:36764398-36764420 GGCGGGCGGCGGGCGGCGGGAGG - Intergenic
953099230 3:39809399-39809421 CGCGGGCGGCACGCGCCGGGAGG - Intronic
953618221 3:44510723-44510745 CGCTGGCGGCGGGCGGCGGGCGG + Intergenic
953618224 3:44510730-44510752 GGCGGGCGGCGGGCGGCGGGCGG + Intergenic
953618227 3:44510737-44510759 GGCGGGCGGCGGGCGGCGGGCGG + Intergenic
953618230 3:44510744-44510766 GGCGGGCGGCGGGCGGCGGGCGG + Intergenic
953618233 3:44510751-44510773 GGCGGGCGGCGGGCGGCGGGCGG + Intergenic
954110252 3:48429500-48429522 CCCGGGCGGCGGGCGGGGGGAGG - Intronic
954717464 3:52533743-52533765 CGCGGGCGGCGGGCGGCGCGCGG - Exonic
954796076 3:53161869-53161891 AGGGGGCGGCGGGCGGGGGTAGG - Intronic
956675094 3:71725484-71725506 GGCGGGCGGCGGGCGGCGGGCGG - Intronic
956675097 3:71725491-71725513 GGCGGGCGGCGGGCGGCGGGCGG - Intronic
960902224 3:122564434-122564456 CGGGGACGGCGGGCGCAGGTGGG - Exonic
961827525 3:129606753-129606775 CGGGGGCGGCTGGCGCGGGCAGG - Exonic
963035161 3:141019498-141019520 CCCGGGCCGCGGGCGCAGCTGGG - Intergenic
968008882 3:195260296-195260318 CGCGGGCGTCGGGCGTTGGGCGG - Intronic
968090554 3:195895937-195895959 CGCGGGAGGCGGGCGCTGGGAGG - Intronic
968448514 4:664227-664249 CGCGGGCGGAGGGGGCACGAGGG + Intronic
968479171 4:826232-826254 CGCGGGCGCCGGGCGGGGGCGGG + Intergenic
968518343 4:1024123-1024145 GGCGGGCGGGGGGTGCTGGTGGG + Intronic
968659675 4:1793837-1793859 GGCGGGAGGCGGGCGCCGCTCGG - Exonic
968674734 4:1871421-1871443 CGGCGGCGGCGGGCGCAGCGCGG - Intronic
968693349 4:2008280-2008302 CGGGGGAGGCGGGGGCGGGTGGG + Intronic
969344861 4:6564023-6564045 CGCGGGGTGCGGGCGCGGGGCGG + Intergenic
970195617 4:13547711-13547733 CGCGGGCGGCGGGCGGAGAGCGG + Intergenic
970637197 4:18022032-18022054 CGCGGGCGGCGGGAGCGGTATGG - Intergenic
971405622 4:26319473-26319495 GGCGGGCGGCGGGCGCGGGCGGG - Intronic
973279284 4:48341961-48341983 GTCGGGCGGCGGGCCCGGGTCGG + Exonic
975661036 4:76689391-76689413 CGGGTGCGGCGGGCGCGGGGTGG + Intronic
975801068 4:78059115-78059137 CGGCGGCGGCGGGCGCAGGGCGG + Intronic
978351523 4:107825028-107825050 CGGGGGCGGCGGCCGCGGGAGGG + Intronic
979231509 4:118352914-118352936 CCCTGGCGGCGGCCGCGGGTGGG + Exonic
979829506 4:125281892-125281914 CGCGGGGGGGGGGCGGGGGTGGG + Intergenic
985064062 4:186104741-186104763 CGCGGGCGGCGGGCGGCGGGCGG + Intronic
985997030 5:3602784-3602806 TGCGGGCGTCGGGAGCGGGTAGG - Intergenic
990753142 5:59039537-59039559 CTCGGGCGGCAGGCGCAGCGCGG + Intronic
990895935 5:60700174-60700196 CGCGGGCTGCGGGCGCTGATTGG + Intronic
991675444 5:69086097-69086119 CGCGGGAGGCTGGCTGAGGTGGG - Intergenic
992950364 5:81852000-81852022 GGCGGGAGGCGGCCGCAGGACGG - Intergenic
995047866 5:107670950-107670972 CTCGGGCGGCGGCGGCAGGCCGG + Intergenic
996747111 5:126854791-126854813 CCCGGGCTGGGGGCGCAGGCCGG + Intergenic
997253673 5:132410823-132410845 GGCGCGCGGCGGGCGCGGGCCGG - Intronic
998130836 5:139650351-139650373 CTCGCGCGGCGGGCGCTGTTTGG + Intronic
998292196 5:140926514-140926536 CGCTGGCTGCGGGCGCAGGGCGG - Intronic
1001064987 5:168529356-168529378 GGCGGGCGGCGGGGGCAGGACGG - Exonic
1001064993 5:168529370-168529392 GGCGGGCGGCGGGCGGCGGGCGG - Exonic
1001529971 5:172454639-172454661 CGCGCGCGGTGGGCGGGGGTCGG - Intergenic
1001906608 5:175478646-175478668 CGCGGGCGGCAGGCCCAGCCAGG + Intronic
1002139865 5:177132401-177132423 CTCGGGCAGCGGGCGCCGGCCGG - Intergenic
1002638324 5:180618974-180618996 CGCGGGCGGCGGGGGAATGGAGG - Intronic
1002861160 6:1080575-1080597 CCCTGGGGGCGGGGGCAGGTTGG + Intergenic
1003062855 6:2876148-2876170 CGTGGGCGGCGGGCGCCGCAGGG + Intergenic
1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG + Intergenic
1004043903 6:12009023-12009045 CGCGCGCGGAGGGCGGAGGGCGG + Intronic
1004168035 6:13274114-13274136 CGGGGGCGTCGGGCGGGGGTGGG - Intronic
1004562092 6:16760918-16760940 CCCGGGCGGGGGGCGCGGGCGGG - Intronic
1006319598 6:33312741-33312763 CGCCGGGTGTGGGCGCAGGTGGG + Intronic
1008160394 6:48068875-48068897 GGCGGGCGGCGGGCGCCGCGGGG + Intergenic
1009899681 6:69796636-69796658 GGCGGGCGGCGGGGGCAGGGGGG - Intronic
1012474791 6:99606914-99606936 CGCGGGCGGAGGACGCACGTCGG + Exonic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1013441761 6:110179097-110179119 GGCGGACCGCGGGCGCGGGTGGG + Intronic
1013575744 6:111482724-111482746 AGCGGGCGCCGGGCGCGGGGCGG - Intronic
1013619378 6:111873144-111873166 CGCGGGCGGCGGCCGCCGGGCGG + Exonic
1014724943 6:124962527-124962549 CGCGGGCCGCGGGCGGCGATGGG + Exonic
1014947475 6:127515618-127515640 CGCGAGCGGCGGGGGCATGCAGG - Exonic
1015328557 6:131951237-131951259 CGCTGGCGGTGGTCGGAGGTGGG + Exonic
1015525855 6:134175135-134175157 CGCCGGCGGAGGGCGCGGGGAGG + Intronic
1016474391 6:144410572-144410594 CCTGGGCGGGGGGTGCAGGTGGG - Intronic
1017073768 6:150599972-150599994 CCCGGGCGGCGCTCGCAGGTCGG - Exonic
1018091278 6:160348387-160348409 CGCGGGCTGCGGGCGGCGGGCGG + Exonic
1018091326 6:160348635-160348657 CGCGGGAGGCGGGCGCCGTGCGG - Exonic
1018682548 6:166275823-166275845 CGCGGGCGGCGGGCGGCAGGCGG - Intergenic
1019563071 7:1667449-1667471 CTCGGGCGGCGTGTGCAGGGAGG + Intergenic
1020080266 7:5282904-5282926 CGCGGGGGGCGGGCAGAGGCGGG + Intronic
1020137421 7:5594693-5594715 CGCGCGCGGCGGGCGAAGGGCGG - Intronic
1020278296 7:6637481-6637503 CGCGGGCGGCAGGTGCGGGCGGG + Intronic
1025069767 7:55887808-55887830 GGCGGGCGGCGGGCGGCGGGCGG + Intronic
1025069770 7:55887815-55887837 GGCGGGCGGCGGGCGGCGGGCGG + Intronic
1025069773 7:55887822-55887844 GGCGGGCGGCGGGCGGCGGGCGG + Intronic
1026850319 7:73719556-73719578 CGCTGGCGGCGGGCGGCGGGCGG + Intronic
1026909458 7:74083881-74083903 CGGGGGCGGAGGGCGCGGGCCGG - Intronic
1028856170 7:95596517-95596539 CTCGGGCGGCGGCGGCTGGTGGG - Intergenic
1030021477 7:105279199-105279221 GGCGGGCGGCGGGGGGAGGAGGG + Intronic
1031369801 7:120950937-120950959 CGCTGGCGGCGGCCGCCAGTGGG + Intronic
1031991340 7:128201212-128201234 CCCGGGCAGCGGGCACAGTTGGG + Intergenic
1033732908 7:144195872-144195894 CGCGGTGCGCGGGCGCAGGTCGG + Intergenic
1033743760 7:144294452-144294474 CGCGGTGCGCGGGCGCAGGTCGG + Intergenic
1033750141 7:144355145-144355167 CGCGGTGCGCGGGCGCAGGTCGG - Intergenic
1034455497 7:151167808-151167830 CGGCGGCGGCGGGCGGAGGGAGG - Intronic
1034545477 7:151786054-151786076 CGCTGGGGGTGGGCGCTGGTGGG + Intronic
1034969469 7:155410160-155410182 CGCGGGGAGGGGGCGCAGGACGG + Intergenic
1035082995 7:156233171-156233193 CGCGGGCGGCGGGCGGGGTCGGG + Intergenic
1035274158 7:157737492-157737514 CCCGGGCAGGGGGCGCAGGCAGG + Intronic
1035476018 7:159144794-159144816 CGGAGGCGGCGGGCGCTGGGCGG - Exonic
1035717208 8:1763664-1763686 CGACGGCGGCGGGCGCGGGAGGG - Intronic
1035786614 8:2266225-2266247 CACGGGCGGCTGGAGCAGGCAGG + Intergenic
1035806193 8:2455491-2455513 CACGGGCGGCTGGAGCAGGCAGG - Intergenic
1037450739 8:19013830-19013852 CGGGGGCGGAGGGCGGAGGGCGG + Intronic
1038319482 8:26514105-26514127 CGCGGGGGGCGTGGGCAGGGAGG + Intergenic
1039454615 8:37698458-37698480 CGGGGGCGGCGGGCGGGGGGAGG - Exonic
1039554722 8:38467845-38467867 GGCGGGCGGCGAGCGGAGGGAGG + Exonic
1041068059 8:54101577-54101599 CGCGGGGGGCGGGGGCAGCCGGG - Intronic
1041108942 8:54467462-54467484 CCCCGGCGTCGGGCGCAGCTGGG - Intergenic
1041374074 8:57194030-57194052 TGCGGGCTGCGGGAGGAGGTGGG + Intergenic
1042785084 8:72537361-72537383 CGGGGGCGGAGGGCGGAGGGCGG - Intergenic
1047499184 8:125429404-125429426 GGCGGGCGGCAGGCGCGGGGGGG + Intergenic
1049532254 8:143160366-143160388 CGCGGGGGGCGGGGGCGGCTGGG + Intronic
1049645484 8:143733929-143733951 CGCGGGCCGGGGGCGCGGGCTGG - Intergenic
1049761463 8:144333751-144333773 CGGGGCGGGCGGGCGCAGCTTGG - Exonic
1049774366 8:144397715-144397737 TGGGGGCTGGGGGCGCAGGTAGG - Intronic
1050873979 9:10612906-10612928 CGCCGGCTGCGGGCGCGGCTGGG + Intergenic
1055501515 9:76906455-76906477 CGCGGTCAGCGGGGGAAGGTGGG + Intergenic
1056592514 9:87974762-87974784 CGCCGGGGGCGGGGGCAGATAGG - Intergenic
1057097581 9:92325932-92325954 CGCGGGTGAAGCGCGCAGGTCGG + Exonic
1057489249 9:95508799-95508821 CGCGGCCGGCGGGAGCAGCGGGG - Intronic
1059115759 9:111599211-111599233 AGCGGGCGGCGGGCGGCGGGAGG - Intronic
1060849174 9:126860625-126860647 CGGGGGCGGGGGGCGCGGGCTGG + Intergenic
1060965841 9:127711971-127711993 GGCGGGCGGCGGGTGCAGGCTGG + Intronic
1060974302 9:127755365-127755387 AGCGGGGGGCGGGCGGAGGGAGG - Intronic
1061128209 9:128689740-128689762 CGCGCGCGGGGGGCGCCGGGCGG + Intronic
1062230672 9:135479967-135479989 CGTGGGACGCGGGCGCAGGCGGG + Exonic
1062537771 9:137028365-137028387 CGCGGGCGGCGGGCGCCTCCTGG - Intronic
1062594991 9:137295520-137295542 TGCGGGCGGCGGCCACAGGGCGG + Intergenic
1203524540 Un_GL000213v1:73580-73602 CGTGGGCGGCGGCTGCAGGTAGG + Intergenic
1203469186 Un_GL000220v1:108755-108777 CCCGGCCGCCGGGCGCGGGTCGG + Intergenic
1203477007 Un_GL000220v1:152727-152749 CCCGGCCGCCGGGCGCGGGTCGG + Intergenic
1185477075 X:421812-421834 GACGGGAGGCGGGAGCAGGTGGG - Intergenic
1188005475 X:25013431-25013453 CGCGGGCGGCGGCGGCACGAAGG + Exonic
1189323036 X:40097640-40097662 CGCGGGCGGCGGCGGCAGCGCGG - Intronic
1190008138 X:46759214-46759236 CGCGGGCGGGGGGCGGTGCTTGG - Intergenic
1190324890 X:49200239-49200261 CGGGGGCGGCGCGCGCTCGTTGG + Exonic
1190745914 X:53321487-53321509 TGCGGGTGGCAGCCGCAGGTGGG - Intergenic
1192211097 X:69128585-69128607 CTCTGGCTGCGGGAGCAGGTCGG + Intergenic
1192344496 X:70290007-70290029 CGAGGGCGGAGCGCGCACGTCGG - Intronic
1194765175 X:97841550-97841572 AGCGGGCGGGGGGCGGGGGTGGG - Intergenic
1198302427 X:135344946-135344968 CCCGGGCGGCGGGCGCCGGAAGG + Intronic
1199724753 X:150568908-150568930 GGCCGGCGGCGGGCGAAGGTCGG + Intronic
1200242662 X:154506062-154506084 CTCGGGCTGTGGGAGCAGGTTGG + Intergenic