ID: 1003603769

View in Genome Browser
Species Human (GRCh38)
Location 6:7541843-7541865
Sequence GGCCGGCGCGGAGAAAGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003603769_1003603773 -4 Left 1003603769 6:7541843-7541865 CCTCCGCTTTCTCCGCGCCGGCC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1003603773 6:7541862-7541884 GGCCCGCCTCGCTTATGCCTCGG 0: 1
1: 0
2: 0
3: 2
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003603769 Original CRISPR GGCCGGCGCGGAGAAAGCGG AGG (reversed) Exonic
900179146 1:1303737-1303759 GGCTGGGGCTGAGAAAGGGGAGG - Intronic
900244539 1:1631159-1631181 CGCCGGCGCGGAAAACGGGGAGG + Intergenic
901086338 1:6614210-6614232 GGCCGACGAGGGGAAAGCGGGGG - Intronic
901279833 1:8025864-8025886 AGCCGGCGTGGAGAAGGCGGCGG + Intronic
903077913 1:20786673-20786695 GGCGGGGGCGGAGAACCCGGGGG + Exonic
903845952 1:26280115-26280137 GGCCGGCGGGCAGAGGGCGGCGG - Exonic
905151413 1:35930969-35930991 GGCCGGCGCGGAGGACGCCGGGG - Intronic
905175200 1:36130972-36130994 GGCAGGCCTGGAGAAAGCTGAGG - Intergenic
905912247 1:41662698-41662720 GGCGGGCGCGGAGGGAGGGGCGG - Intronic
906567965 1:46814020-46814042 GGCAGGCCCGCAGGAAGCGGCGG - Exonic
906640717 1:47439016-47439038 GGCTGCCGCGGCGAAAGCGAAGG - Exonic
906961421 1:50421485-50421507 GCCCGGCGCGGCGACGGCGGCGG - Exonic
908195463 1:61742666-61742688 GGCGGGCGGGGAGAGCGCGGGGG - Intronic
910338244 1:86156789-86156811 GGCCTGGGAGGAGAAAGGGGTGG + Intronic
919103542 1:193122145-193122167 GGCAGGCGCGGCGGCAGCGGCGG + Exonic
920184642 1:204152211-204152233 GGGCGGGGCGGAGCCAGCGGAGG - Intergenic
923008031 1:230067468-230067490 GGGCGGCGCGGAGAGGGCAGGGG - Intronic
923087524 1:230712858-230712880 GGCAGGAGAGGAGAAGGCGGAGG - Intronic
1062982477 10:1736989-1737011 GGCCGGGGTGGAGAAGCCGGGGG + Intronic
1069474527 10:68721192-68721214 GGGCGGCGTGGAGGAAGAGGGGG + Exonic
1069818404 10:71212885-71212907 GGACGGCGAGGAGGAGGCGGCGG + Exonic
1074377438 10:112951449-112951471 GGGCGGCGAGGGGACAGCGGCGG - Intronic
1074864155 10:117535285-117535307 CGCCTGCGCGGAGAGAGCTGCGG - Intergenic
1074923736 10:118046573-118046595 GGGAGGCGCGGAGGCAGCGGAGG - Exonic
1075393805 10:122112891-122112913 GGCCGGGGAGGAGAGCGCGGCGG + Intronic
1077063644 11:628234-628256 GGCCGCGGCGGCGAAGGCGGAGG - Intergenic
1077374742 11:2200190-2200212 GGCCAGGGCAGAGAAAGCAGTGG + Intergenic
1077674431 11:4183913-4183935 GGCCACCGTGGAGAAAGCTGTGG + Intergenic
1079361978 11:19777202-19777224 GGCCGGCGGGGAGCGAGCGAGGG + Intronic
1080457691 11:32430903-32430925 GCCTGGCGCGGAGAGTGCGGGGG + Intronic
1081805019 11:45885767-45885789 GCGCGGCGCGGAGGAGGCGGCGG - Exonic
1082076597 11:47980405-47980427 GGCCGGCTCGGAGGGGGCGGGGG + Intergenic
1083039149 11:59669218-59669240 AGAGGGCGCGGAGAAAGAGGGGG - Intergenic
1083424081 11:62574041-62574063 GGCCAGCGCGGAAAAAGCTCGGG + Exonic
1089713687 11:120336377-120336399 GGCGCGCGCGCAGACAGCGGAGG - Intergenic
1090768253 11:129895597-129895619 GGCCTGCGCGGCGGAAGGGGCGG + Intergenic
1091154419 11:133360591-133360613 GGACGGAGGGGAGAAAGGGGAGG + Intronic
1091402438 12:189143-189165 TGCAGGCGGGGAGAAGGCGGCGG + Intergenic
1092213357 12:6662910-6662932 GGAGGGTGCGGAGAAAGAGGGGG - Intronic
1093958838 12:25251087-25251109 CGCCGGCGGGGAGAAGGAGGGGG + Intergenic
1094199354 12:27780571-27780593 GGCCCGCGCGGGGAAAAGGGCGG + Exonic
1096649368 12:53054344-53054366 GGGCCGCGCGGGGAAGGCGGCGG - Exonic
1102764677 12:115422478-115422500 GGCTGGAGCAGAGAAAGCAGGGG - Intergenic
1106232300 13:27830094-27830116 GGCCGGCGCGGAGCCTGGGGCGG + Intergenic
1106798457 13:33231691-33231713 GGCCAGCAGGGAGAAAGCTGGGG + Intronic
1109302633 13:60604888-60604910 GGCTGGCGGGGACTAAGCGGGGG + Intergenic
1111396067 13:87671807-87671829 GCTCGGCGCGGAGACAGCGTCGG + Intergenic
1112709614 13:102112341-102112363 GGCAGGTGTGGAGAAGGCGGGGG - Intronic
1113938087 13:114005729-114005751 GGCCGGAGGGGAGAAAGGGATGG - Intronic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1119003978 14:70907795-70907817 GGCCGGGGCGGGGACGGCGGCGG + Exonic
1119622097 14:76138897-76138919 GGCCGGCCCGAACAATGCGGCGG + Intergenic
1120881326 14:89417118-89417140 GGACGGGGCGGGGAGAGCGGCGG - Intronic
1122776078 14:104117495-104117517 GGCGGGCGCGGCGACAGCGACGG + Intergenic
1123716719 15:23039233-23039255 GGCCGGCGGGGAGCAGGCGGTGG + Intronic
1125589274 15:40844400-40844422 GGCCGGCCGGGAGGAAGTGGCGG - Intronic
1126392890 15:48178242-48178264 GGCCGAGGCGGAGGCAGCGGCGG - Exonic
1127982704 15:64046331-64046353 GGCAGGCGCGGCGGGAGCGGCGG + Intronic
1130682495 15:86008881-86008903 GGCAGGTGGGGAGAAAGGGGAGG + Intergenic
1130900557 15:88204023-88204045 GGCAGGTGGGGAGAAAGGGGAGG - Intronic
1132055649 15:98648873-98648895 GGCCGGCGCGGGGCGGGCGGCGG + Intergenic
1132405910 15:101541789-101541811 GCCTGGCGCGGAGACAGTGGTGG + Intergenic
1132495938 16:263470-263492 GGCTGGCGAGGAGACAGCGCTGG + Intronic
1132877125 16:2144880-2144902 GGCCGGCGAGGGCAAGGCGGGGG - Intronic
1132877134 16:2144901-2144923 GGCCGGCGAGGGCAAGGCGGGGG - Intronic
1136170717 16:28487609-28487631 GGCAGGAGCTGAGAAAGGGGAGG - Intronic
1136449257 16:30343401-30343423 GGGCTTCGCGGAGAAGGCGGAGG + Intergenic
1136458481 16:30395569-30395591 GGCCGGCAAGGTGAGAGCGGCGG + Exonic
1136541039 16:30927832-30927854 GGCGGGGGCGGTGGAAGCGGTGG - Exonic
1136544723 16:30948684-30948706 GCCCGGCGAGGGGCAAGCGGGGG + Exonic
1140723116 16:77788691-77788713 GGAAGGCGTGGAGAAGGCGGAGG + Exonic
1142120350 16:88383695-88383717 GGGCGGCCCGGAGGAGGCGGCGG - Intergenic
1142164310 16:88577555-88577577 GGACGAGGCTGAGAAAGCGGGGG + Exonic
1143099871 17:4499080-4499102 GGGCGGCGCGGAGGAGGAGGAGG + Exonic
1145919275 17:28598537-28598559 GGTCAGCGAGGAGCAAGCGGGGG + Exonic
1146956056 17:36936902-36936924 GGCCCGGGCGGCGACAGCGGCGG + Intronic
1148664099 17:49361921-49361943 GGCCGGGGCGGCGGAGGCGGAGG - Intronic
1155654553 18:28177933-28177955 GGCGAGCGCGGGGAGAGCGGCGG - Intergenic
1156099739 18:33578729-33578751 GACCGGCGCGGGGCGAGCGGCGG - Intronic
1158505615 18:58044214-58044236 GGAGGGGGCGGAGAGAGCGGGGG + Intergenic
1160736114 19:663127-663149 GGGCGGCGCGGAGTAGGTGGCGG - Exonic
1161349667 19:3784857-3784879 GCCAGGCTCGGAGGAAGCGGGGG + Exonic
1162250135 19:9435541-9435563 TGGCGGCGCGGAGAAAGCGCCGG + Intronic
1162975844 19:14206659-14206681 GGGCGGCGCGGAGCTGGCGGAGG + Intergenic
1163507951 19:17719470-17719492 GGCGGGCGCCGAGAACGCCGGGG + Exonic
1166042849 19:40213803-40213825 GGCCGGCGCGGGGAAAGAAGAGG - Exonic
1166091639 19:40513071-40513093 CGGCGGCGCGGCGAGAGCGGCGG + Exonic
1167040605 19:47020781-47020803 GGGCGGCGCGGGGGAGGCGGCGG + Intronic
1167234252 19:48304085-48304107 GGAGCGCGCGGAGAAAGAGGAGG - Exonic
1167425164 19:49426457-49426479 GGCCGGCGAGGAGGAAGACGAGG - Exonic
1167557454 19:50205241-50205263 GCCCGCCGCGGAGAAGGCTGAGG - Intronic
1168336517 19:55600333-55600355 GGCCGGCGCGTGGGAAGGGGAGG - Intronic
1168643349 19:58044524-58044546 GGCCGCCGCGGAGAAGGAGGAGG + Intronic
927372730 2:22375883-22375905 GGCTGGCAAGGAGAAATCGGAGG - Intergenic
929791404 2:45025595-45025617 GGCAGGCCCGGAGAAGGTGGGGG + Intergenic
931242003 2:60461905-60461927 GGCCGGCCTGGGGACAGCGGTGG + Exonic
933794967 2:85912343-85912365 GGCTGGCACTGAGAAGGCGGGGG - Intergenic
934125898 2:88889764-88889786 GGCCTGCGGGGGGAGAGCGGGGG - Intergenic
934566845 2:95346224-95346246 GGCCCGCGCGGAGTCGGCGGCGG - Intronic
937996976 2:127701606-127701628 GCTCGCCGCGGAGAAGGCGGAGG + Exonic
938583930 2:132670748-132670770 GGCCTTCGCGGAGGAAGAGGGGG - Intronic
947435171 2:230067198-230067220 GGCTGCCGCGGAGAAGGCTGGGG + Intronic
947593055 2:231395921-231395943 GGCCGGCGCGGCGCGCGCGGGGG - Intronic
948378804 2:237539246-237539268 GGCCGGCTGGGAGAAGGCGGTGG + Intronic
948631382 2:239304994-239305016 GGCCGGCTGGAAGAAAGCGCGGG - Intronic
1171504795 20:25624363-25624385 GGGCGGCGCGGAGACGTCGGCGG + Intergenic
1174714967 20:52747990-52748012 GACGGGAGGGGAGAAAGCGGAGG + Intergenic
1175977440 20:62718100-62718122 GGCCGGAGCGGAGGGAGCAGAGG + Intronic
1176234834 20:64049379-64049401 GGCGGGCGCGGCGAGGGCGGCGG + Exonic
1176418920 21:6499018-6499040 GGCCGGCGCGGCGGTGGCGGGGG - Intergenic
1179694413 21:43107340-43107362 GGCCGGCGCGGCGGTGGCGGGGG - Intronic
1181571231 22:23768591-23768613 GGCCGGCCCGGGGAATCCGGTGG - Intronic
1183452832 22:37906171-37906193 GGGCAGCGCGGAGTAGGCGGCGG + Intronic
1184037840 22:41926827-41926849 GGCCCTCGGGGAGGAAGCGGGGG + Intergenic
1184086801 22:42270379-42270401 GGCGGGCGGGGAGGGAGCGGTGG + Intronic
1184680981 22:46071996-46072018 GGCGGGCGCGGGGACAGCGTGGG - Intronic
1184738932 22:46415947-46415969 GGCCGGCGTGGAGCACGAGGCGG + Intronic
949987763 3:9553529-9553551 GGCCCGCGAGGAGCAGGCGGTGG + Intronic
951898381 3:27632889-27632911 CGGCGGCGCGGAGGCAGCGGCGG - Intergenic
951898385 3:27632906-27632928 CGGCGGCGCGGAGGCAGCGGCGG - Intergenic
951898389 3:27632923-27632945 CGGCGGCGCGGAGGCAGCGGCGG - Intergenic
951898393 3:27632940-27632962 CGGCGGCGCGGAGGCAGCGGCGG - Intergenic
954437443 3:50503534-50503556 GCCCCTCGCGGAGAAGGCGGCGG - Intronic
956761299 3:72447206-72447228 GGCCGGCGCCGCGAGGGCGGAGG + Intergenic
967272610 3:187743728-187743750 GGCGGGCGGGGAGAAAGGGCGGG - Intronic
967732202 3:192917213-192917235 AGCCGGCGTCGGGAAAGCGGAGG + Intronic
967851036 3:194083019-194083041 GGCCGGCGGGCAGGAAGTGGGGG + Intergenic
967859713 3:194141649-194141671 GCCCGGGGCGGGGGAAGCGGGGG - Intergenic
968636656 4:1684403-1684425 GGCCGGCGTGGAGAAGGCGGCGG - Intergenic
969715945 4:8868199-8868221 GGCCGGCACGGAGGAGGCGTCGG - Exonic
970008016 4:11428817-11428839 GGCGGGCGGGGAGAAGGCGCAGG + Exonic
978126971 4:105146632-105146654 GGCCGGGGCGGAGCAGGAGGAGG + Exonic
982461017 4:155668124-155668146 GACAGGCGCGGAGACCGCGGTGG - Intronic
992067296 5:73120158-73120180 GGGGGGCGCGGAGGAAGCGCCGG - Intergenic
997222552 5:132181297-132181319 GGCCTGCGCGGGGGAAGGGGTGG + Intergenic
999269594 5:150289028-150289050 GGCAGGAGCTGAGAAAGGGGAGG + Intronic
1002441269 5:179265672-179265694 GGCCGGCGCTGGGAAAGCCGAGG - Intronic
1002454123 5:179336646-179336668 GCCCGGGGGTGAGAAAGCGGTGG - Intronic
1003603769 6:7541843-7541865 GGCCGGCGCGGAGAAAGCGGAGG - Exonic
1006370387 6:33640561-33640583 GGCGGGGGCAGAGGAAGCGGAGG - Intronic
1006599114 6:35214130-35214152 GGCCGGCTTGGAGAGGGCGGGGG + Intergenic
1007082146 6:39115153-39115175 GGCCGGCGCGGGCCGAGCGGAGG - Exonic
1010703166 6:79077290-79077312 GGCCGGCGCGGGGTCTGCGGGGG - Intronic
1011470255 6:87701520-87701542 GGCCGCAGCGGAGAAGGAGGCGG + Exonic
1011640379 6:89412008-89412030 GGCCGGCCCGGGGACGGCGGGGG + Exonic
1016010744 6:139135492-139135514 GGCGGGCGCGGCGGGAGCGGCGG + Exonic
1018613029 6:165662100-165662122 GGCCGGCGCCGGGGAAGCCGGGG + Intronic
1018613212 6:165662676-165662698 GGCCGGCGGGGGGAGCGCGGCGG - Intronic
1019264792 7:108899-108921 GGCAGGCTAGGAGGAAGCGGTGG - Intergenic
1019472710 7:1229853-1229875 GGCGGGCGCGGAGGATGAGGGGG + Intergenic
1022100195 7:27164832-27164854 GGCCGGCGTGGAGGCGGCGGCGG + Intronic
1026837393 7:73647873-73647895 CGCCCGCGCGGAGAAGGCGCCGG - Intergenic
1029361060 7:100088975-100088997 GGCGGGCGCGGGGAAAATGGCGG + Exonic
1029362989 7:100100706-100100728 GGCGGCCGCGGAGAGAGCTGCGG - Intronic
1029491943 7:100875391-100875413 GGCGGGCGCGGAGAAACTCGGGG + Intronic
1029580466 7:101433713-101433735 GGGTGGCTCGGAGAAAGAGGGGG + Intronic
1032469945 7:132170974-132170996 GGCAGGCACGAAGAAAGCAGAGG - Intronic
1034441154 7:151086686-151086708 GGGCGGCGCGGCGGAGGCGGCGG - Intronic
1034880348 7:154757970-154757992 GGGCGGCGGGGAGAGGGCGGGGG - Intronic
1036723842 8:11201440-11201462 GGGGGGCGGGGAGGAAGCGGGGG + Intergenic
1037901581 8:22692228-22692250 GGACGGCGGGGAGAAGGAGGGGG - Intronic
1037951222 8:23019678-23019700 GGCCGGGGCAGAGAAAGTGAAGG + Intronic
1038035459 8:23682844-23682866 GCCCGGGGAGGCGAAAGCGGAGG - Exonic
1041208299 8:55521102-55521124 GGCCGGCGTGAAGGAAGGGGAGG + Intronic
1043463839 8:80486519-80486541 GTCCCGCGCGGAGAAGGGGGCGG - Exonic
1049762204 8:144336669-144336691 GCCGGGCCCGGAGAACGCGGTGG + Intergenic
1053381281 9:37651162-37651184 GGGCGGCGCGGAGGAAGCCGAGG - Intronic
1056413331 9:86353983-86354005 GCCCGACGTGGAGAAAGAGGAGG + Intronic
1056475215 9:86946492-86946514 GGCCGAGGCCGGGAAAGCGGCGG + Exonic
1056992318 9:91423656-91423678 GGCCGGCGAGGAGAAAGAAAGGG + Exonic
1057466247 9:95317256-95317278 GGCCAGGGCGGGGAAAGCGGGGG - Intronic
1057881543 9:98796338-98796360 GGCGGGCGCGGAGCCGGCGGGGG - Exonic
1058110704 9:101028708-101028730 GGCTGGCGCGGAGGGGGCGGAGG - Exonic
1058843649 9:108934426-108934448 GGGCTGCGCGGAGGAAGCGCTGG + Exonic
1060376666 9:123120502-123120524 GGCAGGGGCGGGGAAAGCAGGGG + Intronic
1061127986 9:128689006-128689028 GGCCGGAGAGGGGAGAGCGGGGG + Intronic
1196893569 X:120311669-120311691 GGGCTGCGCAGAGAAAGAGGGGG + Intergenic
1197118449 X:122861835-122861857 GGCAGGCATGGAGAAAGCAGAGG - Intergenic