ID: 1003605225

View in Genome Browser
Species Human (GRCh38)
Location 6:7553798-7553820
Sequence GCTCCTCCAGGCAGGCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 1, 2: 9, 3: 46, 4: 421}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003605225_1003605235 11 Left 1003605225 6:7553798-7553820 CCCCTGGGCCTGCCTGGAGGAGC 0: 1
1: 1
2: 9
3: 46
4: 421
Right 1003605235 6:7553832-7553854 TCTGGGAGTAGTTCCCAGGGAGG No data
1003605225_1003605230 -7 Left 1003605225 6:7553798-7553820 CCCCTGGGCCTGCCTGGAGGAGC 0: 1
1: 1
2: 9
3: 46
4: 421
Right 1003605230 6:7553814-7553836 GAGGAGCCTGTGTCTTCTTCTGG 0: 1
1: 0
2: 1
3: 32
4: 210
1003605225_1003605231 -6 Left 1003605225 6:7553798-7553820 CCCCTGGGCCTGCCTGGAGGAGC 0: 1
1: 1
2: 9
3: 46
4: 421
Right 1003605231 6:7553815-7553837 AGGAGCCTGTGTCTTCTTCTGGG 0: 1
1: 1
2: 3
3: 32
4: 302
1003605225_1003605233 7 Left 1003605225 6:7553798-7553820 CCCCTGGGCCTGCCTGGAGGAGC 0: 1
1: 1
2: 9
3: 46
4: 421
Right 1003605233 6:7553828-7553850 TTCTTCTGGGAGTAGTTCCCAGG 0: 1
1: 1
2: 1
3: 8
4: 184
1003605225_1003605237 17 Left 1003605225 6:7553798-7553820 CCCCTGGGCCTGCCTGGAGGAGC 0: 1
1: 1
2: 9
3: 46
4: 421
Right 1003605237 6:7553838-7553860 AGTAGTTCCCAGGGAGGTCTGGG No data
1003605225_1003605236 16 Left 1003605225 6:7553798-7553820 CCCCTGGGCCTGCCTGGAGGAGC 0: 1
1: 1
2: 9
3: 46
4: 421
Right 1003605236 6:7553837-7553859 GAGTAGTTCCCAGGGAGGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 154
1003605225_1003605234 8 Left 1003605225 6:7553798-7553820 CCCCTGGGCCTGCCTGGAGGAGC 0: 1
1: 1
2: 9
3: 46
4: 421
Right 1003605234 6:7553829-7553851 TCTTCTGGGAGTAGTTCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003605225 Original CRISPR GCTCCTCCAGGCAGGCCCAG GGG (reversed) Intronic