ID: 1003616560

View in Genome Browser
Species Human (GRCh38)
Location 6:7659997-7660019
Sequence TGTCCCTCTCTAACAGTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003616558_1003616560 -3 Left 1003616558 6:7659977-7659999 CCAGGCCAAAGCTTCACGTGTGT No data
Right 1003616560 6:7659997-7660019 TGTCCCTCTCTAACAGTGAGTGG No data
1003616559_1003616560 -8 Left 1003616559 6:7659982-7660004 CCAAAGCTTCACGTGTGTCCCTC No data
Right 1003616560 6:7659997-7660019 TGTCCCTCTCTAACAGTGAGTGG No data
1003616555_1003616560 23 Left 1003616555 6:7659951-7659973 CCTGGAAACCAGTGCACTACTGC No data
Right 1003616560 6:7659997-7660019 TGTCCCTCTCTAACAGTGAGTGG No data
1003616556_1003616560 15 Left 1003616556 6:7659959-7659981 CCAGTGCACTACTGCGAGCCAGG No data
Right 1003616560 6:7659997-7660019 TGTCCCTCTCTAACAGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003616560 Original CRISPR TGTCCCTCTCTAACAGTGAG TGG Intergenic
No off target data available for this crispr