ID: 1003621657

View in Genome Browser
Species Human (GRCh38)
Location 6:7706064-7706086
Sequence CTGAGGAAAAATACCCAGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003621657_1003621659 2 Left 1003621657 6:7706064-7706086 CCGTACTGGGTATTTTTCCTCAG No data
Right 1003621659 6:7706089-7706111 GCATTTAGCCCTGCAGTGTATGG No data
1003621657_1003621665 20 Left 1003621657 6:7706064-7706086 CCGTACTGGGTATTTTTCCTCAG No data
Right 1003621665 6:7706107-7706129 TATGGGGTTCATCTAGTTTTGGG No data
1003621657_1003621661 4 Left 1003621657 6:7706064-7706086 CCGTACTGGGTATTTTTCCTCAG No data
Right 1003621661 6:7706091-7706113 ATTTAGCCCTGCAGTGTATGGGG No data
1003621657_1003621666 30 Left 1003621657 6:7706064-7706086 CCGTACTGGGTATTTTTCCTCAG No data
Right 1003621666 6:7706117-7706139 ATCTAGTTTTGGGAGACTATTGG No data
1003621657_1003621660 3 Left 1003621657 6:7706064-7706086 CCGTACTGGGTATTTTTCCTCAG No data
Right 1003621660 6:7706090-7706112 CATTTAGCCCTGCAGTGTATGGG No data
1003621657_1003621664 19 Left 1003621657 6:7706064-7706086 CCGTACTGGGTATTTTTCCTCAG No data
Right 1003621664 6:7706106-7706128 GTATGGGGTTCATCTAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003621657 Original CRISPR CTGAGGAAAAATACCCAGTA CGG (reversed) Intergenic
No off target data available for this crispr