ID: 1003623144

View in Genome Browser
Species Human (GRCh38)
Location 6:7720098-7720120
Sequence TACCTGGGTGGTGGTTATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003623144_1003623150 -2 Left 1003623144 6:7720098-7720120 CCTGTATAACCACCACCCAGGTA No data
Right 1003623150 6:7720119-7720141 TAAGGAAATAGACCAACTGTTGG No data
1003623144_1003623151 -1 Left 1003623144 6:7720098-7720120 CCTGTATAACCACCACCCAGGTA No data
Right 1003623151 6:7720120-7720142 AAGGAAATAGACCAACTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003623144 Original CRISPR TACCTGGGTGGTGGTTATAC AGG (reversed) Intergenic
No off target data available for this crispr