ID: 1003623150

View in Genome Browser
Species Human (GRCh38)
Location 6:7720119-7720141
Sequence TAAGGAAATAGACCAACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003623144_1003623150 -2 Left 1003623144 6:7720098-7720120 CCTGTATAACCACCACCCAGGTA No data
Right 1003623150 6:7720119-7720141 TAAGGAAATAGACCAACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003623150 Original CRISPR TAAGGAAATAGACCAACTGT TGG Intergenic