ID: 1003623151

View in Genome Browser
Species Human (GRCh38)
Location 6:7720120-7720142
Sequence AAGGAAATAGACCAACTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003623146_1003623151 -10 Left 1003623146 6:7720107-7720129 CCACCACCCAGGTAAGGAAATAG No data
Right 1003623151 6:7720120-7720142 AAGGAAATAGACCAACTGTTGGG No data
1003623144_1003623151 -1 Left 1003623144 6:7720098-7720120 CCTGTATAACCACCACCCAGGTA No data
Right 1003623151 6:7720120-7720142 AAGGAAATAGACCAACTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003623151 Original CRISPR AAGGAAATAGACCAACTGTT GGG Intergenic