ID: 1003623247

View in Genome Browser
Species Human (GRCh38)
Location 6:7720838-7720860
Sequence GTGAGACCCAGAACGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003623247_1003623254 22 Left 1003623247 6:7720838-7720860 CCCTTCTTCGTTCTGGGTCTCAC No data
Right 1003623254 6:7720883-7720905 CTGCCCTGGCTCTTATCTGGAGG No data
1003623247_1003623252 19 Left 1003623247 6:7720838-7720860 CCCTTCTTCGTTCTGGGTCTCAC No data
Right 1003623252 6:7720880-7720902 CACCTGCCCTGGCTCTTATCTGG No data
1003623247_1003623251 8 Left 1003623247 6:7720838-7720860 CCCTTCTTCGTTCTGGGTCTCAC No data
Right 1003623251 6:7720869-7720891 CATCAAGATGTCACCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003623247 Original CRISPR GTGAGACCCAGAACGAAGAA GGG (reversed) Intergenic