ID: 1003623250

View in Genome Browser
Species Human (GRCh38)
Location 6:7720860-7720882
Sequence GTGACATCTTGATGTCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003623250_1003623257 25 Left 1003623250 6:7720860-7720882 CCAGGCTGACATCAAGATGTCAC No data
Right 1003623257 6:7720908-7720930 CTAAGTAAGAATCTGCTTCTAGG No data
1003623250_1003623254 0 Left 1003623250 6:7720860-7720882 CCAGGCTGACATCAAGATGTCAC No data
Right 1003623254 6:7720883-7720905 CTGCCCTGGCTCTTATCTGGAGG No data
1003623250_1003623252 -3 Left 1003623250 6:7720860-7720882 CCAGGCTGACATCAAGATGTCAC No data
Right 1003623252 6:7720880-7720902 CACCTGCCCTGGCTCTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003623250 Original CRISPR GTGACATCTTGATGTCAGCC TGG (reversed) Intergenic