ID: 1003623253

View in Genome Browser
Species Human (GRCh38)
Location 6:7720882-7720904
Sequence CTCCAGATAAGAGCCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003623253_1003623257 3 Left 1003623253 6:7720882-7720904 CCTGCCCTGGCTCTTATCTGGAG No data
Right 1003623257 6:7720908-7720930 CTAAGTAAGAATCTGCTTCTAGG No data
1003623253_1003623258 13 Left 1003623253 6:7720882-7720904 CCTGCCCTGGCTCTTATCTGGAG No data
Right 1003623258 6:7720918-7720940 ATCTGCTTCTAGGCTTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003623253 Original CRISPR CTCCAGATAAGAGCCAGGGC AGG (reversed) Intergenic
No off target data available for this crispr