ID: 1003623256

View in Genome Browser
Species Human (GRCh38)
Location 6:7720887-7720909
Sequence AGAGCCTCCAGATAAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 2, 1: 1, 2: 8, 3: 23, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003623256_1003623258 8 Left 1003623256 6:7720887-7720909 CCTGGCTCTTATCTGGAGGCTCT 0: 2
1: 1
2: 8
3: 23
4: 194
Right 1003623258 6:7720918-7720940 ATCTGCTTCTAGGCTTATTCAGG No data
1003623256_1003623257 -2 Left 1003623256 6:7720887-7720909 CCTGGCTCTTATCTGGAGGCTCT 0: 2
1: 1
2: 8
3: 23
4: 194
Right 1003623257 6:7720908-7720930 CTAAGTAAGAATCTGCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003623256 Original CRISPR AGAGCCTCCAGATAAGAGCC AGG (reversed) Intergenic
901469070 1:9443124-9443146 AGAAACTCCAGATCTGAGCCAGG + Intergenic
902190013 1:14755767-14755789 TTAGCCTCCAATTAAGAGCCGGG + Intronic
904754089 1:32758568-32758590 CGGGCTTCCAGATAAGAGGCTGG + Intronic
905513857 1:38546218-38546240 TGAGCCTCAAGATGAGATCCAGG - Intergenic
905918452 1:41702121-41702143 AAAGCATCCAGGTAAGGGCCTGG + Intronic
908752771 1:67440579-67440601 ACAGCCCCCAGATCAAAGCCAGG - Intergenic
909283708 1:73788983-73789005 AGTGCCTCCAGATTAGAGTCAGG + Intergenic
909686763 1:78357564-78357586 AGACCTTCCAAATAAGAGGCAGG - Intronic
910007959 1:82423061-82423083 TGAGCTTCCGGATAAGAGCGTGG + Intergenic
910451187 1:87347345-87347367 AGAGCATCCCCATTAGAGCCGGG - Exonic
910799778 1:91133441-91133463 AGAGCCTGCACATAAGTTCCAGG - Intergenic
911166513 1:94729448-94729470 AGAGCTTCCAGAACAAAGCCAGG - Intergenic
912056198 1:105601269-105601291 AGAGGCTCCAGACAATAGCCAGG - Intergenic
912658433 1:111507945-111507967 AGAGGCTCCAGATCAGCCCCCGG - Intronic
912777985 1:112518314-112518336 TGAGCCTGTAGAAAAGAGCCTGG - Intronic
913192137 1:116421816-116421838 AGAGCCTCCAGAAAAAAGTGCGG + Intergenic
915930574 1:160058282-160058304 ACAGCCTGCAGAGAAGAGCTAGG - Intronic
918406267 1:184214362-184214384 AGAGGCTCCAGGAAGGAGCCCGG - Intergenic
919503043 1:198362108-198362130 ACAGCCTACAGATAGGAGCAGGG - Intergenic
920888347 1:209956389-209956411 AGAGCCACAAGCTAGGAGCCTGG - Intronic
922536775 1:226386738-226386760 AGAAACACCAGGTAAGAGCCTGG + Intronic
924608794 1:245557087-245557109 AGTGCCTCCACAAAAGTGCCAGG + Intronic
1065778269 10:29142830-29142852 AGGGCCTCCAGAGGAGAGCGCGG + Intergenic
1065961537 10:30737982-30738004 AAGGCCTCCAGGTGAGAGCCTGG - Intergenic
1066339996 10:34522323-34522345 AGAGCCTCGAGAAAGGAGCACGG + Intronic
1072349049 10:94540078-94540100 AGACCCTCCAGATAAGGCACTGG - Intronic
1073486247 10:103820714-103820736 AAAGCCCCCAGATAAGGGGCGGG + Intronic
1074476678 10:113780753-113780775 AGAGCCAGCAGAAAGGAGCCAGG + Intronic
1075180688 10:120207981-120208003 AGAGGCTTCAGATAAGAGGCTGG + Intergenic
1076637713 10:131893190-131893212 AGAGCCTCCAGAAAGGGGCGTGG - Intergenic
1077786594 11:5390701-5390723 AGAGCACCCAGAGGAGAGCCTGG + Intronic
1078291624 11:10016081-10016103 AGAGTGTTCAGATAAGAGCAAGG - Intronic
1078933317 11:15929822-15929844 AGAGGCACCACATGAGAGCCAGG - Intergenic
1082664896 11:55963496-55963518 AGAGCCTCCAGACAAGAACTTGG + Intergenic
1082796084 11:57378863-57378885 TGAGTCTCCAGGCAAGAGCCCGG + Intronic
1084534842 11:69750617-69750639 ACAGACTCCAGCAAAGAGCCAGG + Intergenic
1085126517 11:74006037-74006059 AGAGCCTCCTCATAAGCGTCCGG + Intronic
1088599553 11:111462566-111462588 GGAACCTGCAGGTAAGAGCCAGG - Intergenic
1090231991 11:125113925-125113947 AGAGACCCCAGGTCAGAGCCTGG + Intergenic
1090461169 11:126892754-126892776 ACAGCCTCCAGATAGGAGAAGGG + Intronic
1091059682 11:132449855-132449877 AGACCCTCATGAAAAGAGCCAGG - Intronic
1091702533 12:2673578-2673600 AGAGCCTCCAGAAGAGACCATGG - Intronic
1092120969 12:6043650-6043672 AGAACATCCACATAGGAGCCAGG + Intronic
1092573091 12:9746977-9746999 AGAGCTTCCAGAAAACAACCAGG - Intergenic
1093703161 12:22245893-22245915 AGAGCTTCCAGATAAGAAGGTGG + Intronic
1094144518 12:27214545-27214567 AGAGCCTTCAGAGTAGACCCCGG + Intergenic
1095943407 12:47740449-47740471 AGTGCCCCCAGACAACAGCCAGG + Intronic
1096124386 12:49109111-49109133 CTAGCCTCTAGATGAGAGCCAGG + Intronic
1099803981 12:87494245-87494267 AGAGCCTGCAGATGAGATCCTGG + Intergenic
1100180749 12:92083509-92083531 AGAGCCTCCAGAAAAAGCCCAGG - Intronic
1100870349 12:98904287-98904309 AGGGCCTCCAGAAAATAGACAGG + Intronic
1101715216 12:107305356-107305378 AAAGCCTCCAGCCAAGAGCCAGG + Intergenic
1102599141 12:114015926-114015948 AGAGCTTACAGCTAAGAGCATGG - Intergenic
1102778038 12:115537952-115537974 TGAGCCTTCAGATAAGACCCTGG + Intergenic
1107777558 13:43862352-43862374 AGACCCAACAGATAATAGCCAGG - Intronic
1107839171 13:44437517-44437539 AAAGACTCCAGATAAAATCCAGG + Intronic
1107976482 13:45693351-45693373 AGAGCCTTCAGAACAGAGCCAGG + Intergenic
1108512014 13:51164881-51164903 AGAGGGTCCAGATAAGAGTTTGG + Intergenic
1111948958 13:94694590-94694612 TGAGCCTCCAGGTGAGAGCTTGG + Intergenic
1112241222 13:97683502-97683524 AAAGCCTCCAGCTAAAAGCCAGG + Intergenic
1112899307 13:104339626-104339648 AGGGCCTCCAGATATGGACCTGG - Intergenic
1117912138 14:60646802-60646824 AGAGCCTCCTGTTAGGAGCCAGG + Intronic
1118299889 14:64605907-64605929 AGAGGCTACAGAGAAGATCCAGG + Intergenic
1118759635 14:68872208-68872230 AGAGCCTCCAGATAGAATGCAGG - Intergenic
1119890393 14:78178158-78178180 AGAGGCTTCAGAGCAGAGCCAGG - Intergenic
1120011418 14:79419829-79419851 AGAGCTCCCAGTTATGAGCCAGG - Intronic
1122384221 14:101333118-101333140 AGAGCCTCGTGGTGAGAGCCAGG - Intergenic
1122878570 14:104679768-104679790 AGATCCCCTAGAGAAGAGCCAGG - Intergenic
1125878837 15:43174504-43174526 AGAGCCCCCATATAAGAGGCTGG - Intronic
1126310635 15:47312519-47312541 AGAACCTCCAGACATGTGCCTGG + Intronic
1130996732 15:88908332-88908354 AGAGCCTCAAGACCAGAGCTCGG + Intronic
1131029260 15:89172892-89172914 TAAGCCTCCAGAAAGGAGCCTGG + Intronic
1134829982 16:17315129-17315151 AGAGACTACAGAAAAAAGCCAGG + Intronic
1137428580 16:48400123-48400145 AGAACCTCCAGAAAGGAGCATGG - Intronic
1137585258 16:49660492-49660514 AGAGCCTCCAGCTGGAAGCCAGG + Intronic
1137586330 16:49665882-49665904 AGAGCCTCAAGAAAAGGGCATGG + Intronic
1139187386 16:64822907-64822929 AGAGCCTCTAGATAAGAGCATGG - Intergenic
1140350690 16:74259500-74259522 GGAGCCTCCAGAGTAAAGCCAGG - Intergenic
1141708531 16:85683553-85683575 TGGGCCTCCAGCCAAGAGCCTGG + Intronic
1141990243 16:87605106-87605128 AGAGCCTCCTGGCCAGAGCCTGG - Intronic
1142135064 16:88448192-88448214 ACAGTCTCCAGGCAAGAGCCTGG + Intergenic
1143392594 17:6568576-6568598 AGAGCCTTGAGTTAAGAGCCTGG - Intergenic
1143503058 17:7350109-7350131 CGAGCCTGGAGAGAAGAGCCAGG - Exonic
1144131785 17:12253502-12253524 AGAGGCTCCAGAGAAGAAGCAGG - Intergenic
1144354210 17:14428643-14428665 ACCGCCTCCAGATAAAAGCTGGG + Intergenic
1145767529 17:27469179-27469201 AGAGCCTCGAGAGAAGAGCCGGG - Intronic
1145888010 17:28396222-28396244 AGAGCCTGCAGATGAGTCCCGGG - Exonic
1146300486 17:31685443-31685465 ATAGGGTCCAGGTAAGAGCCTGG + Intergenic
1147325450 17:39667615-39667637 GGAGCCCCCAGATAAGCGGCTGG + Intergenic
1148444180 17:47727655-47727677 CCAGCCTGCAGATGAGAGCCTGG + Intergenic
1148621997 17:49041777-49041799 ACAGCCTGCAGCTAGGAGCCAGG + Intronic
1151169476 17:72234950-72234972 AGGGTCTCCAGAAAAGAGACTGG - Intergenic
1151816752 17:76474887-76474909 AGAGCCTCCAGGAAGGGGCCAGG + Intronic
1152253295 17:79222915-79222937 AGACCCTCCAGAATGGAGCCCGG - Intronic
1152278678 17:79372603-79372625 AGAGCCTCCAGCCAGGAGACTGG - Intronic
1154024586 18:10695582-10695604 AGAGTCTCCACATAGGAGACTGG - Intronic
1155444945 18:25901238-25901260 AGAACCTCTAGATGAGAACCTGG + Intergenic
1155734343 18:29202236-29202258 AGAGCCTGCAGATGAGGTCCTGG + Intergenic
1156259330 18:35430071-35430093 AGAGCCTCCAGAAAGGAAGCAGG - Intergenic
1156266619 18:35494666-35494688 AGAGCCTTCAGACAAGAACTCGG + Intronic
1156677708 18:39550672-39550694 AGAGGCACCAGTTAAGTGCCAGG - Intergenic
1163143503 19:15365453-15365475 GGAGCCTCCAGGAGAGAGCCAGG - Intronic
1164925086 19:32124230-32124252 AGAGCTTCCAGAAAAGAACAGGG + Intergenic
1166540336 19:43600957-43600979 AGAGCAACAAGATAGGAGCCTGG + Exonic
1167136574 19:47619776-47619798 TCAGCCTCCAGATTAGATCCAGG - Intronic
1167416482 19:49375828-49375850 AGAGCCTCCCAATGAGAGCTCGG - Intergenic
1167636360 19:50658314-50658336 GGAGCCACTAGATAAGAGCGTGG + Intronic
925552606 2:5092796-5092818 ACAGCCTCCAGCCGAGAGCCAGG - Intergenic
926421646 2:12705510-12705532 TGAGCCTTCAGATGAGAGCACGG + Intergenic
926574440 2:14564503-14564525 AGAGCCTCCAGAAAGGAACAGGG + Intergenic
926848823 2:17172347-17172369 AGAGCCTCCACAAAAGCTCCTGG + Intergenic
927410181 2:22815835-22815857 AGAGGCACCAGTTTAGAGCCTGG - Intergenic
931034001 2:58216153-58216175 AGAGCTTCCAAGCAAGAGCCAGG - Intronic
932126835 2:69152222-69152244 AGAACCACCAGAGGAGAGCCAGG - Exonic
932450975 2:71810663-71810685 CGTGCCTCCAGATAAGCTCCAGG + Intergenic
935082377 2:99810783-99810805 AGAGCCTCCAGAACAGAACGTGG - Intronic
935484797 2:103640111-103640133 AGAGGCTCCACACAAGGGCCTGG + Intergenic
938638548 2:133254942-133254964 AGAGCTTTCAGTTAGGAGCCTGG + Intronic
940276247 2:151943703-151943725 AAAGCCTCCAGAAAATAGCCAGG + Intronic
945651087 2:212560148-212560170 AGAGCTTCCAGATAAGAACCTGG + Intergenic
946450867 2:219777930-219777952 ATAGCCTCCGGATAAAAACCTGG - Intergenic
948030252 2:234811915-234811937 AGAGGCTCCAGAAAGGAACCTGG - Intergenic
948122774 2:235543475-235543497 AGAGCATCCAGAGAAGAAGCTGG + Intronic
948493753 2:238331663-238331685 AGATCGTCCACAGAAGAGCCTGG - Intronic
948561909 2:238859974-238859996 TCAGCCTCTAGATGAGAGCCAGG + Intronic
1171487536 20:25495284-25495306 TGAGCCTGCAGATGGGAGCCTGG - Intronic
1172142181 20:32730772-32730794 AGAGCCTCTAGCACAGAGCCAGG + Intronic
1172164954 20:32893388-32893410 AGAGACTCCAGAGCAGAGGCAGG - Intronic
1173693883 20:44990557-44990579 ACAGCCTCTAGACAAGAGACCGG - Intronic
1175193431 20:57226252-57226274 GGAGAATCCAGATAACAGCCTGG + Intronic
1175869756 20:62203137-62203159 AGAGCATCAAGATGAAAGCCAGG - Intronic
1175992758 20:62797583-62797605 AGAGTCTCCAGCTGAGACCCTGG + Intronic
1176137170 20:63529291-63529313 GGAGCCTGCAGATGAGATCCGGG - Exonic
1181795411 22:25305214-25305236 AGATCCTCTAGATAAGAACCCGG + Intergenic
1181835950 22:25608731-25608753 GGAGCCTGTAGATAAGAACCCGG + Intronic
1182353547 22:29711836-29711858 AGGGTCTCCAGAGAAGACCCAGG + Intergenic
1182778713 22:32850536-32850558 AGAGCTCCCAGCTAGGAGCCAGG + Intronic
1184311525 22:43647885-43647907 AGAGCCAGCAGATGAGAGCATGG + Intronic
1185173347 22:49305804-49305826 AGAGGGTCCAGCTCAGAGCCTGG - Intergenic
949728170 3:7075359-7075381 AAAGGTTCCAGAGAAGAGCCTGG - Intronic
951755815 3:26089791-26089813 AGAGCCCCCAGATGTGAGTCAGG - Intergenic
954092729 3:48298008-48298030 AGACCCTCCAGATAAGGACCTGG + Intronic
954903882 3:54043336-54043358 AGAGCCTCCAGGGAAGGCCCTGG + Intergenic
955858834 3:63305145-63305167 AAAGCCTCCAGGCAATAGCCAGG + Intronic
957305999 3:78459626-78459648 AAAGCCTACAGATGAGATCCTGG + Intergenic
957314915 3:78564633-78564655 AGAGCCTGCAGATGAGATCCTGG - Intergenic
958435590 3:94092006-94092028 AGAGCCTCCCAATGAGTGCCAGG + Intronic
959697390 3:109263358-109263380 TGAGCCTCCAGATAAGACAGTGG + Intergenic
962579844 3:136788471-136788493 AGAGACTCCAGATGAAGGCCAGG + Intergenic
963735721 3:149015955-149015977 ACTGGCTTCAGATAAGAGCCAGG + Intronic
964279303 3:155045568-155045590 AGAGCCTACTGATACCAGCCTGG - Intronic
964445101 3:156750288-156750310 AAAGGCTCCAGATAAGAGACAGG + Intergenic
966877592 3:184332076-184332098 ACAGCCTCCCAGTAAGAGCCAGG + Exonic
968079142 3:195834623-195834645 AGAGCCTCCAGATGAGGGAACGG + Intergenic
968960648 4:3741554-3741576 AGAGCCTCCAAAGCACAGCCAGG - Intergenic
969065319 4:4474789-4474811 AGAGCCTCCAGAAAAGAACACGG + Intronic
969395243 4:6916284-6916306 GGAGCGTCCAGAGAGGAGCCGGG + Intronic
972713077 4:41618102-41618124 AGAGCCTTAAACTAAGAGCCAGG - Intronic
975412797 4:74074383-74074405 AGAGCCTTCAAATGAGAGCTTGG + Intergenic
979217521 4:118183226-118183248 AGAGCCTGCAGATGAGATTCTGG - Intronic
980795732 4:137680161-137680183 AGAGTCTCCAGAAGGGAGCCTGG + Intergenic
984520332 4:180794880-180794902 AGAGCTTCCAGAAAAGAGAAAGG - Intergenic
985049348 4:185973701-185973723 GGAGCCTCCAGATGAGGTCCTGG - Intergenic
989254662 5:39353197-39353219 AGAGCCTCCAGAAAGGAATCTGG + Intronic
990067442 5:51735832-51735854 ACAGCCTCCAGATATGAGCCTGG - Intergenic
990728781 5:58785999-58786021 AGAGCCTCCAGAAAGGAACTTGG + Intronic
992071956 5:73156419-73156441 AGGGCCTCCTGACAAGGGCCTGG + Intergenic
992921275 5:81524318-81524340 AGAGCCTCTAGGTAAGAGTCTGG + Intronic
997240248 5:132301481-132301503 GGAGCCTCCAGCAAAGGGCCTGG + Intronic
997714180 5:136029608-136029630 AGCGACTCCAGACAAGAACCTGG + Intronic
1000050933 5:157562401-157562423 TGAGGCTCCAGAGGAGAGCCCGG - Intronic
1001162196 5:169329953-169329975 AGAGCCTCCAGAAAGGAGGGTGG - Intergenic
1001522636 5:172405632-172405654 AGGTCTTCCAGATAAGAGCTTGG + Intronic
1001883926 5:175271224-175271246 GGAGCATCCAGAGAAGAGGCAGG - Intergenic
1002101577 5:176860572-176860594 AGAGCCTCCAGCTGAGACACTGG - Intronic
1003436079 6:6089663-6089685 AGAGTCTCCAGAAAAGAACATGG + Intergenic
1003623256 6:7720887-7720909 AGAGCCTCCAGATAAGAGCCAGG - Intergenic
1005247405 6:23903650-23903672 AGAGTCTCCAAATAAGAGTCTGG + Intergenic
1005839974 6:29737912-29737934 AGAGCCTCCAGAGTGGGGCCAGG - Intronic
1006454840 6:34125755-34125777 GGAACCTCCAGACCAGAGCCAGG - Intronic
1006484224 6:34324976-34324998 ATAGCCTCCAGTGAAGGGCCTGG - Intronic
1011765423 6:90614663-90614685 AGACCCTCCAGACAAATGCCAGG + Intergenic
1012242179 6:96885800-96885822 CCAGCCTCTAGATAAGTGCCTGG + Intergenic
1013627155 6:111949822-111949844 AGAGCTTCCAGATAAGAGCCTGG + Intergenic
1013878691 6:114866500-114866522 AGAGCATCCAGACAAAAGCCAGG + Intergenic
1015272621 6:131352987-131353009 AGAGCCTTCAGATGAGAGCCTGG + Intergenic
1017488412 6:154923426-154923448 CCAGACTCCTGATAAGAGCCAGG + Intronic
1021725598 7:23545196-23545218 AGTGCCTACAGAAAAGAGTCAGG - Intergenic
1021791671 7:24212120-24212142 ACAGCCTCTAGATAAGAGGAGGG + Intergenic
1022303872 7:29128119-29128141 AGAACCTGCAGATGAGATCCTGG + Intronic
1023140780 7:37100353-37100375 AGAGCATTCAGAGGAGAGCCTGG - Intronic
1024020568 7:45364229-45364251 AGAGCTCCCAGGTCAGAGCCAGG - Intergenic
1028410778 7:90528463-90528485 AGAGACTCAAGAGAAGAGCCTGG - Intronic
1028733525 7:94180297-94180319 AGAGACTCCAGAAAGGAACCTGG - Intergenic
1029657126 7:101934690-101934712 AAAGCCTCATGACAAGAGCCAGG - Intronic
1031866408 7:127042215-127042237 AGGGCCTCCAGAGCAGAGACAGG + Intronic
1033175264 7:139117818-139117840 TGAGCATCCTGATAAGAACCAGG - Intergenic
1033987962 7:147249814-147249836 GGAGCCTCCAGCAAAGAGCACGG - Intronic
1034565864 7:151915358-151915380 AGAACGTCCAGATAAAAGCAAGG - Intergenic
1035249373 7:157586945-157586967 AGAGCATCCAGAGATGACCCTGG - Intronic
1035643600 8:1201469-1201491 AGAGCCTCCAGAAGGAAGCCAGG + Intergenic
1035903944 8:3488695-3488717 AACGCTTCCAGATAAGAGGCCGG + Intronic
1039179804 8:34853992-34854014 AGAGCCTGCAGATGAGAATCTGG - Intergenic
1040689766 8:49922255-49922277 AGATTCTCCAGATAATTGCCTGG + Intronic
1042156287 8:65847656-65847678 ATATCCTCCAGGCAAGAGCCTGG + Intergenic
1042781560 8:72496376-72496398 AGAGCCTCCAGAGAAGAGGCCGG + Intergenic
1042941000 8:74107758-74107780 AGAGAGTCCAGAGTAGAGCCTGG - Intergenic
1046691623 8:117292167-117292189 AGACCCTCCCAATAAGAACCTGG + Intergenic
1051339914 9:16101764-16101786 ATAGCCTCCAGTTGACAGCCAGG + Intergenic
1052328911 9:27247257-27247279 AGAACCCCCAGAAAAGAACCTGG + Intergenic
1053203124 9:36166124-36166146 AGAGACCCCAGAGAAGGGCCTGG - Intergenic
1055098098 9:72435095-72435117 AGAGCCTCCAAATGAGAGCCTGG - Intergenic
1058573536 9:106374711-106374733 GGAGTCTCCAGATAAAAGTCCGG - Intergenic
1059097453 9:111433762-111433784 GGGGCCTCCAGATAAGAGGGTGG + Intronic
1059383381 9:113945940-113945962 AGAGACTCCAGATCAGGGACTGG - Intronic
1059404971 9:114093857-114093879 AGAGCCACCAGCTTGGAGCCAGG - Intronic
1059564690 9:115372032-115372054 CCAGCCTCCAGATAGGAGGCTGG - Intronic
1061133824 9:128722356-128722378 AGAGCCTGCAGCACAGAGCCTGG + Intronic
1061324335 9:129853867-129853889 AGTGCCTCTAGATCAGAGACTGG + Intronic
1062058113 9:134479428-134479450 TGAGCCTCCAGATGAGACCCCGG - Intergenic
1062572228 9:137190976-137190998 AGAGGGTCCAGAAAAGAGCTGGG + Intergenic
1189531078 X:41883824-41883846 AGAATCTCCAGAGAACAGCCAGG + Intronic
1189861240 X:45274873-45274895 AGGGCATCCAGAGAAAAGCCAGG - Intergenic
1189997076 X:46649326-46649348 AGAGCCTGCAAATAAGAGGTGGG + Intronic
1195616144 X:106913696-106913718 AGAGCCTCCAGATAAGAGCCCGG - Intronic
1196046852 X:111265593-111265615 ACAGCCTCCAGAAAGGAGTCTGG - Intronic
1196348507 X:114697941-114697963 AGAGCCTCTAGATAAGAGCTGGG - Intronic
1199821041 X:151446694-151446716 ACAGCCTTCAGAAAAGAGCATGG + Intergenic