ID: 1003623257

View in Genome Browser
Species Human (GRCh38)
Location 6:7720908-7720930
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003623256_1003623257 -2 Left 1003623256 6:7720887-7720909 CCTGGCTCTTATCTGGAGGCTCT No data
Right 1003623257 6:7720908-7720930 CTAAGTAAGAATCTGCTTCTAGG No data
1003623253_1003623257 3 Left 1003623253 6:7720882-7720904 CCTGCCCTGGCTCTTATCTGGAG No data
Right 1003623257 6:7720908-7720930 CTAAGTAAGAATCTGCTTCTAGG No data
1003623255_1003623257 -1 Left 1003623255 6:7720886-7720908 CCCTGGCTCTTATCTGGAGGCTC No data
Right 1003623257 6:7720908-7720930 CTAAGTAAGAATCTGCTTCTAGG No data
1003623250_1003623257 25 Left 1003623250 6:7720860-7720882 CCAGGCTGACATCAAGATGTCAC No data
Right 1003623257 6:7720908-7720930 CTAAGTAAGAATCTGCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003623257 Original CRISPR CTAAGTAAGAATCTGCTTCT AGG Intergenic