ID: 1003623258

View in Genome Browser
Species Human (GRCh38)
Location 6:7720918-7720940
Sequence ATCTGCTTCTAGGCTTATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003623253_1003623258 13 Left 1003623253 6:7720882-7720904 CCTGCCCTGGCTCTTATCTGGAG No data
Right 1003623258 6:7720918-7720940 ATCTGCTTCTAGGCTTATTCAGG No data
1003623256_1003623258 8 Left 1003623256 6:7720887-7720909 CCTGGCTCTTATCTGGAGGCTCT 0: 2
1: 1
2: 8
3: 23
4: 194
Right 1003623258 6:7720918-7720940 ATCTGCTTCTAGGCTTATTCAGG No data
1003623255_1003623258 9 Left 1003623255 6:7720886-7720908 CCCTGGCTCTTATCTGGAGGCTC No data
Right 1003623258 6:7720918-7720940 ATCTGCTTCTAGGCTTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003623258 Original CRISPR ATCTGCTTCTAGGCTTATTC AGG Intergenic
No off target data available for this crispr