ID: 1003624150

View in Genome Browser
Species Human (GRCh38)
Location 6:7727259-7727281
Sequence TGCCGGAGCGCCGGGGGCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 1, 2: 1, 3: 48, 4: 375}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003624150_1003624158 16 Left 1003624150 6:7727259-7727281 CCGCAGCCCCCGGCGCTCCGGCA 0: 1
1: 1
2: 1
3: 48
4: 375
Right 1003624158 6:7727298-7727320 CAGCAGCAGCAGCTGCCTCGCGG 0: 1
1: 0
2: 8
3: 139
4: 744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003624150 Original CRISPR TGCCGGAGCGCCGGGGGCTG CGG (reversed) Exonic
900130959 1:1087088-1087110 TGCCGGTGTCCTGGGGGCTGGGG - Intronic
900396994 1:2457134-2457156 TGCAGGATGGCCTGGGGCTGGGG + Intronic
901060017 1:6467682-6467704 TGTCTGGGCGCAGGGGGCTGTGG - Intronic
901109811 1:6785581-6785603 AGCCGGAGCGCGAGGGGCTGGGG + Intronic
901816263 1:11795112-11795134 TGCTGAAGCGCCTGGGGATGTGG - Exonic
902025937 1:13383550-13383572 GGCCGGTCCGCCGGGCGCTGTGG + Intergenic
902350110 1:15847965-15847987 TGCCGGGGCGGCGGCGGCGGCGG - Exonic
902629520 1:17696426-17696448 TGAGGGTGCTCCGGGGGCTGGGG + Intronic
902916611 1:19643830-19643852 TGCCGGGACGCGGCGGGCTGGGG + Intronic
903153285 1:21428207-21428229 GGCCGGAGCGCGGGCGGCGGCGG + Intergenic
903468382 1:23568157-23568179 TCCGGGACCGCCGGGGGTTGGGG - Intergenic
903883772 1:26529798-26529820 AGCCGGAGCGCGAGGGGCTCGGG + Intronic
907775008 1:57505752-57505774 TGCCTGAGCCCAGGAGGCTGAGG - Intronic
908132022 1:61083236-61083258 TGCCGCAGCGCCCGGGGAGGGGG + Intronic
908319004 1:62963163-62963185 GGGCGGAGGGCCTGGGGCTGTGG + Intergenic
908380643 1:63593962-63593984 TCCCGGGGCGCCGGGAGGTGCGG + Intronic
908401406 1:63775038-63775060 GGCCGGAGGGCCGGGGGCGGTGG - Intronic
909037917 1:70615429-70615451 TGCTGGAGCGTGGGGGGCTAGGG + Intergenic
910458554 1:87424225-87424247 TGCCTGAGCCCCAGGGGCAGAGG - Intergenic
910981144 1:92961236-92961258 TGCCGGACGGCAGGGGGCAGCGG + Intronic
912716937 1:111989775-111989797 GGCTGGAGCGGCGGAGGCTGCGG - Intergenic
912927895 1:113929691-113929713 GGCGGGAGCGCGCGGGGCTGAGG + Exonic
915236577 1:154487764-154487786 TGCCTGAGCTCAGGAGGCTGAGG + Intronic
915340784 1:155175580-155175602 TGCGGGAGAGGCGGGGGCTGCGG - Exonic
915519946 1:156436260-156436282 AGCCCGAGGGCCGGGAGCTGCGG + Intergenic
919744737 1:201001462-201001484 TGCCTGAGCCCGGGAGGCTGAGG - Intronic
920180464 1:204129259-204129281 GGCCGGAGGGCAGAGGGCTGAGG - Intergenic
921946196 1:220887622-220887644 TGCAGGAGGGGCGGGGGCCGCGG - Intergenic
922335553 1:224616202-224616224 GACTGCAGCGCCGGGGGCTGAGG - Intronic
922572146 1:226640466-226640488 GGGCCGAGAGCCGGGGGCTGTGG + Intronic
924799664 1:247319063-247319085 TGCCTGAGCCCAGGGGGTTGAGG - Intronic
1064235255 10:13567923-13567945 TGTCGGAGGGTGGGGGGCTGGGG + Intergenic
1065353843 10:24820010-24820032 TGCTGGAGCCCTGGAGGCTGAGG + Intergenic
1066661556 10:37741794-37741816 TGCCGGGACCCCGGGGACTGGGG + Intergenic
1067830974 10:49610814-49610836 TGCAGGAGCCCCGGCGGCAGAGG + Exonic
1068910551 10:62374509-62374531 TGCCGGGGTGGCCGGGGCTGGGG + Intronic
1070032619 10:72692209-72692231 GGCGGGGGCGCCGGCGGCTGCGG + Exonic
1070065235 10:73027443-73027465 TGTCGGAGGGTGGGGGGCTGGGG + Intronic
1070984545 10:80677501-80677523 TGCTGGTGCGCGGGGGGGTGGGG - Intergenic
1072742410 10:97917450-97917472 TGCTGGAGGGGCTGGGGCTGGGG - Intronic
1073221792 10:101880647-101880669 TGCTGGGGGGCCGGGGGTTGTGG - Intronic
1073504012 10:103967610-103967632 GGCCGGAGCTGCGGGGGCCGAGG + Exonic
1076379911 10:130017788-130017810 TGGCTGAGAGCCGGGCGCTGTGG - Intergenic
1076879041 10:133231060-133231082 TGGCGGGGAGCCGGGGGCGGGGG - Exonic
1076985993 11:236400-236422 GGCTGGGGCGCCGGGGGCGGGGG - Exonic
1076986013 11:236439-236461 GACCGGGGCGCCGGGGGCGGGGG - Intronic
1077095812 11:798532-798554 TGGCAGAGCGCCGGTGGATGAGG + Exonic
1077350697 11:2091842-2091864 TGCTGGAGCTCCTGGGCCTGCGG + Intergenic
1078060379 11:8039291-8039313 TGCCGGAGCCCTGGAGGCTGGGG - Intronic
1078168480 11:8910976-8910998 AGGCGGGGCGCCGGGCGCTGGGG - Intergenic
1078514325 11:12009283-12009305 TGCGGGAGCGCGGCGGGGTGCGG + Intronic
1081873023 11:46391755-46391777 AGCCACAGCGCCGGGAGCTGCGG - Intergenic
1082631030 11:55542117-55542139 TGCTGGAGCCCAGGGGTCTGAGG + Intergenic
1083572737 11:63768875-63768897 TGCCAGCTCGCGGGGGGCTGGGG + Intergenic
1083713205 11:64561153-64561175 TGCCCGAGTGCCCTGGGCTGCGG - Intronic
1083812228 11:65112366-65112388 TGCCTGGGGGCCGAGGGCTGAGG + Intronic
1083921958 11:65786176-65786198 TGGTGGAGCGCGGAGGGCTGGGG - Intergenic
1084010888 11:66347722-66347744 AGCCGGCGCGCCGGGGGCTGGGG - Intergenic
1084149814 11:67282836-67282858 TGCAGGGCCGCAGGGGGCTGGGG + Intronic
1084191019 11:67498813-67498835 AGCCGGGGAGCTGGGGGCTGAGG - Exonic
1084646782 11:70463581-70463603 GGCCTGGGAGCCGGGGGCTGCGG + Intergenic
1085157693 11:74311465-74311487 CGCCCGAGCGCCGGCTGCTGGGG - Exonic
1085384560 11:76149707-76149729 TGTCTGAGGGCCGGGGGCAGGGG + Intergenic
1087485852 11:98758992-98759014 CGCAGGAGCGATGGGGGCTGGGG - Intergenic
1092256420 12:6928546-6928568 GGCCTGAGGGCCGGGGGCTCAGG + Intronic
1095981121 12:47975374-47975396 TGCGGGAGCCCTCGGGGCTGCGG + Exonic
1096174144 12:49501033-49501055 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
1096734471 12:53641787-53641809 TGCAGGGGCCCCGGAGGCTGAGG + Intronic
1096969637 12:55655407-55655429 AGCCTGAGCGCCGGGCGCGGTGG + Intergenic
1097190413 12:57216852-57216874 TGCGGGAGCGGCGGGAGCGGCGG - Exonic
1100329331 12:93570317-93570339 AGCCGGAGCGCCAGGGGGAGGGG + Intronic
1100399103 12:94212471-94212493 TGCCGGGGGGTGGGGGGCTGGGG - Intronic
1102278176 12:111598748-111598770 GCCCGGAGCGGAGGGGGCTGGGG + Intronic
1102825959 12:115948177-115948199 TGAGGGAGTGCCAGGGGCTGGGG + Intergenic
1103479270 12:121240744-121240766 TGCGGGGGAGCCGGGGGCGGGGG + Exonic
1104849397 12:131864131-131864153 GGCCGGGGCCCCGGGCGCTGAGG - Intergenic
1104969685 12:132525609-132525631 TGTCGGGGCGCCTGGGGCCGGGG + Intronic
1107467807 13:40665824-40665846 GGCCCGGGCGGCGGGGGCTGCGG + Exonic
1107851823 13:44578023-44578045 TGCCCTAGGGCCGGGAGCTGTGG + Intergenic
1110573067 13:77026944-77026966 GGGCGGAGCGCGGGGGGCCGCGG - Exonic
1113231716 13:108218826-108218848 GGGCCGAGCGCCGGGGGTTGTGG + Intronic
1113552946 13:111207250-111207272 TGCCTGAGCCCAGGAGGCTGAGG - Intronic
1113750407 13:112773075-112773097 TCCCAGAGCCCCGAGGGCTGTGG + Intronic
1114037849 14:18646252-18646274 AGCCGGAGCGGTGGCGGCTGTGG - Intergenic
1114473849 14:22981161-22981183 TGCCGGTGCCCCGGGGTCCGAGG - Intronic
1114483260 14:23048087-23048109 TGCCGGAGCCCAGGGAGCTGAGG + Exonic
1115135569 14:30103468-30103490 TGCCAGAGGGTAGGGGGCTGGGG + Intronic
1115261346 14:31457350-31457372 TGTAGGAGCGCCCGGGCCTGAGG + Exonic
1117092853 14:52267933-52267955 TGCTGGCGCGCTCGGGGCTGGGG + Exonic
1118185578 14:63534701-63534723 TGCCCGAGCCCAGGAGGCTGAGG - Intronic
1119180475 14:72601453-72601475 GGCAGGAGTGCCTGGGGCTGAGG - Intergenic
1119517421 14:75259103-75259125 TCCCTTAGCGCCAGGGGCTGAGG - Intronic
1120790826 14:88580109-88580131 TGCTGGAGCCCGGGAGGCTGAGG + Intronic
1120790835 14:88580141-88580163 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1120790853 14:88580219-88580241 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1121047952 14:90801766-90801788 TGCTGGAGCGCCGGGCACGGTGG + Intronic
1121137382 14:91510633-91510655 GGCCGAAGCGCCGGGGCCCGCGG - Intergenic
1121230135 14:92351567-92351589 TGCAGGCAGGCCGGGGGCTGTGG + Intronic
1121324417 14:93011679-93011701 TGCAGGGGCACCTGGGGCTGAGG + Intronic
1121377793 14:93430417-93430439 GGCTGGAGCGCCGGGGCCGGAGG - Intronic
1121751872 14:96363778-96363800 TTCCGGGGCGCCGAGGTCTGAGG - Exonic
1122092813 14:99351345-99351367 TTCCGGAGCTCTGAGGGCTGTGG - Intergenic
1122172646 14:99889522-99889544 AGCAGGAGGGGCGGGGGCTGTGG + Intronic
1122270761 14:100567676-100567698 GGCCGCTGCGGCGGGGGCTGGGG - Intronic
1122558170 14:102592576-102592598 TGCAGGGGCGCCGGGGGAGGGGG - Intergenic
1122908610 14:104815512-104815534 TGCCGGCGCTCCTGGGGCTTCGG + Intergenic
1122940491 14:104978872-104978894 TGCGGGAGCGCCCAGCGCTGGGG + Intergenic
1122985700 14:105210702-105210724 TGGCGGGGCGCGGGGGGCTGGGG - Intronic
1123039957 14:105486450-105486472 TGCGGGGGCTGCGGGGGCTGGGG - Intergenic
1123041381 14:105491616-105491638 TGCCAGAGCGCGGAGGTCTGCGG - Exonic
1123117369 14:105900745-105900767 TGCGGGGGCTCCGGAGGCTGTGG + Intergenic
1123219921 14:106845216-106845238 TGCCGGAGGGTCTGGGGCTCTGG - Intergenic
1123399891 15:19973852-19973874 AGCAGGAGCGCAGGAGGCTGGGG - Intergenic
1124622040 15:31279295-31279317 TGCAGGACAGCCGGGGCCTGTGG - Intergenic
1125517614 15:40331374-40331396 TGCTGGAGGGGCGGGGGGTGGGG - Intergenic
1126668156 15:51093657-51093679 TGCACAAGCGCCGGGAGCTGTGG + Intronic
1128213004 15:65915435-65915457 TGGCAGAGCCCCGGGGTCTGTGG - Intronic
1128264198 15:66253375-66253397 TGCAGGAGCGCCAGGGGGTCCGG - Intronic
1128743282 15:70097356-70097378 CGCAGGAGCGCCGGAGGGTGAGG + Exonic
1129385240 15:75192627-75192649 TGCTGGAGCAGAGGGGGCTGTGG + Intergenic
1129540247 15:76342553-76342575 TGCCGGGGCTCCGCGTGCTGCGG + Intergenic
1129678935 15:77647072-77647094 TGCGGGAGGGCTCGGGGCTGGGG + Intronic
1132059363 15:98679003-98679025 TGCTGGAGCCCAGTGGGCTGGGG - Intronic
1132549379 16:548064-548086 TGCCCGAGCGCCCGGGCCAGTGG + Exonic
1132665454 16:1079437-1079459 GGCCGGAGCCCGTGGGGCTGTGG + Exonic
1132672967 16:1109276-1109298 TGCCTGAAGGCCGGGGGCTGGGG + Intergenic
1140092013 16:71846288-71846310 CTCCGGGGCGCCGGGGCCTGAGG - Intronic
1140209184 16:72957817-72957839 TGCCGGGGCGGCGGCGGCGGCGG - Exonic
1140927765 16:79599919-79599941 TGGCGGAGCGGCGGCGGCGGCGG - Exonic
1141818745 16:86430830-86430852 GGCCGCAGCGCAGGGGGCTGGGG + Intergenic
1142243664 16:88958677-88958699 TCCCCCAGGGCCGGGGGCTGGGG + Intronic
1142471383 17:165045-165067 TGACGGAGCTCTGGGGGATGCGG + Intronic
1142743192 17:1942309-1942331 TGCCTGAGCCCCGGGGTGTGGGG + Intronic
1142762364 17:2050063-2050085 GGGCGGGGCGGCGGGGGCTGAGG + Intergenic
1143503408 17:7351624-7351646 GGCCTGAGCGCAGGGCGCTGCGG + Intergenic
1144756280 17:17682171-17682193 TCGCGGGGCGCCGGGGGCGGAGG + Intronic
1145018247 17:19412538-19412560 TCCCGGGGCGCCATGGGCTGGGG - Exonic
1146183068 17:30709451-30709473 CGTCAGAGCGCCGGGGGCTGGGG - Intergenic
1146255953 17:31391671-31391693 CTCCGGAGCGGCTGGGGCTGCGG + Exonic
1146332342 17:31937426-31937448 GGCGGCAGCGGCGGGGGCTGCGG + Exonic
1146794186 17:35769751-35769773 AGCGGGAGCTGCGGGGGCTGGGG + Intronic
1148046898 17:44749884-44749906 TGCGGGAGCGTGGGGGGCTGGGG - Intronic
1148050461 17:44767654-44767676 TGCCGGGGCAGCTGGGGCTGGGG - Intronic
1148155836 17:45424997-45425019 TGCAGGAGAGCCAGGGGGTGCGG + Intronic
1148640431 17:49183609-49183631 GGCCTGAGGGCTGGGGGCTGGGG - Intergenic
1148899862 17:50867074-50867096 TGCCGGCGGGGCGGGAGCTGTGG - Intronic
1150250292 17:63700828-63700850 TGCAGAGGCGCCGAGGGCTGGGG - Intronic
1150388855 17:64779755-64779777 AGCCGGAGAGCAGGGGGCGGGGG - Intergenic
1150658317 17:67055256-67055278 TGCCTGAGCGCCGGGGCCGGGGG + Intronic
1150695607 17:67402496-67402518 TGGCGGAGGGGCGGGGGATGGGG - Intronic
1151711409 17:75809076-75809098 GGCTGGAGCGGCGGGGGCGGGGG + Intronic
1152552316 17:81035704-81035726 GGCCGGGGCGGCGGGGGCGGCGG + Intronic
1152815906 17:82407654-82407676 TGCCGCAGGGCCAGTGGCTGTGG - Intronic
1155332309 18:24730746-24730768 TGCCAGAGTGCTGGAGGCTGAGG + Intergenic
1156213837 18:34976941-34976963 TCCCGGAGCGGCGGCGGCGGCGG + Intronic
1157251228 18:46098072-46098094 TGCAGGAGGGCGAGGGGCTGTGG - Intronic
1157592345 18:48843312-48843334 TGCTGGAGCGCAGGGCCCTGGGG - Intronic
1157905010 18:51561971-51561993 TGACAGAGCACTGGGGGCTGGGG + Intergenic
1158075531 18:53523752-53523774 TGTCGGAGGGCAGGGGGCTGGGG + Intronic
1158687011 18:59623681-59623703 GGTTGGAGGGCCGGGGGCTGAGG + Intronic
1160507644 18:79436447-79436469 TGGCGGGGGGCCGGGGGATGTGG + Intronic
1160767038 19:813290-813312 TGCAGGCGCGGCCGGGGCTGGGG - Exonic
1160839271 19:1138283-1138305 TGCCGGAGAGCCTGGGGGTGGGG + Intronic
1160844825 19:1161560-1161582 TGCCTGAGCACTGGGAGCTGGGG + Intronic
1160905589 19:1450296-1450318 TGGCGGGGCGCCTGGGTCTGGGG - Intronic
1161252148 19:3285986-3286008 TGCAGGAGGGGCGGCGGCTGGGG - Exonic
1161317365 19:3623889-3623911 TGCAGGAGCGGCTGCGGCTGCGG - Exonic
1161384793 19:3985238-3985260 GGCCGGAGGACCCGGGGCTGGGG - Intronic
1161487380 19:4543519-4543541 TGCCAGAACGCCGGGGCCCGGGG - Exonic
1161526635 19:4760046-4760068 TGCCGGATGCGCGGGGGCTGGGG + Intergenic
1161628469 19:5339901-5339923 TGCCAGAGCCCCTGGGGCTGGGG + Intronic
1161703023 19:5805230-5805252 TCCCGGGCCGGCGGGGGCTGGGG - Intergenic
1162101782 19:8343231-8343253 TGCGGGCGCGGCTGGGGCTGCGG - Exonic
1162754226 19:12847606-12847628 AGGGGGAGCGCCCGGGGCTGCGG - Exonic
1162791799 19:13066858-13066880 AGCCAGAGGGCCGGGGGATGAGG - Intronic
1162810906 19:13163958-13163980 TGCGGGAGAGCTGGGGGATGGGG - Intergenic
1162975727 19:14206317-14206339 CGTCAGAGCGCCGGGGGCTGGGG + Intergenic
1163655618 19:18543395-18543417 GGCTAGCGCGCCGGGGGCTGCGG - Intronic
1164641301 19:29827927-29827949 TGCCAGAGGGCCGGGTGCGGTGG - Intergenic
1165049858 19:33134554-33134576 TGCAGGGGCGGCAGGGGCTGGGG + Intronic
1165157220 19:33796042-33796064 CGCCGCGGCGCCCGGGGCTGGGG - Intronic
1165333394 19:35153948-35153970 TGCCTGAGCGCGGGAGCCTGAGG + Exonic
1165349619 19:35268870-35268892 TGCAGGAGCGGCGGCGGCTGCGG + Intergenic
1165903191 19:39178298-39178320 TGCAGGAGGGCAGGGGGCGGAGG - Intronic
1166675864 19:44740726-44740748 TGCCTGAGCCTGGGGGGCTGAGG - Intergenic
1166765603 19:45251161-45251183 GGTCGGGGCGCCGGGGGCTCCGG - Intronic
1166840263 19:45692888-45692910 TGCCGCTGGGCCGGGAGCTGCGG + Exonic
1167043371 19:47036022-47036044 TGCTGGAGCAACTGGGGCTGCGG + Exonic
1167268277 19:48493963-48493985 GGCGGGAGCGCCGGGGCCGGCGG - Exonic
1167300131 19:48673202-48673224 TGCTGGACCGCCGGGGGCAACGG - Intergenic
1167501638 19:49851576-49851598 CCCCGGAGCGGCGGGGGCTGCGG - Intronic
1167738783 19:51311928-51311950 TACCGCAGCGCCGGGGGCGGGGG + Intronic
1168013988 19:53556719-53556741 TGCTTGAGCCCAGGGGGCTGAGG - Intronic
1168314593 19:55479107-55479129 TGTGGGAGCGCCCGGGGCTCCGG - Intronic
925850419 2:8076119-8076141 TGCTTGAGCCCAGGGGGCTGAGG + Intergenic
925984821 2:9206994-9207016 GGCCGGAGCGGCGGCGGCAGCGG + Exonic
926120215 2:10237642-10237664 TGCCGCAGCCCCCCGGGCTGAGG + Intergenic
928158038 2:28894591-28894613 GGAGGGAGCGCCGGGGGCTCAGG - Intergenic
928205015 2:29277793-29277815 TGCCAGAGTGGCAGGGGCTGAGG - Intronic
928998732 2:37324823-37324845 GGCCGGAGGGCGGGGGGCCGGGG + Intergenic
930019437 2:46992516-46992538 TGCTTGAGTGCTGGGGGCTGAGG + Intronic
930700671 2:54456254-54456276 GGCGGGAGCGCGGGGGGCGGGGG - Intergenic
931719441 2:65056567-65056589 TGCCGCGGCGCTGGGGGCGGTGG + Intronic
932566848 2:72916203-72916225 CGCCTGAGCGCCGGGAGCCGTGG - Intergenic
932567201 2:72917564-72917586 TGCGGGGACACCGGGGGCTGGGG + Exonic
932777292 2:74535883-74535905 TGCAGGAGGGCAGGGGCCTGGGG + Intronic
937047122 2:118857723-118857745 TGCCGGTGCGTCGGGGCCCGCGG + Intergenic
937322066 2:120966822-120966844 TGCAGGAGCACCGAGGGCAGGGG - Intronic
937883744 2:126886514-126886536 AGCAGGAGCGCGGGGAGCTGAGG - Intergenic
938017105 2:127876264-127876286 TGCCTGAGCCCAGGGGGTTGAGG + Intronic
938073096 2:128318636-128318658 GGCCGGAGCGCGGGCGGCGGCGG - Intergenic
938443115 2:131353270-131353292 AGCCGGAGCGGTGGCGGCTGTGG - Intronic
938555072 2:132416715-132416737 AGGCGGAGCGCCAGGTGCTGCGG + Exonic
940104019 2:150077408-150077430 TGTCGGAGGGTGGGGGGCTGAGG - Intergenic
941786441 2:169504845-169504867 TGTAGGAGCGCCCGGGCCTGAGG - Exonic
942248582 2:174028699-174028721 TGCCGGAGGGCTGGGTGCTGTGG - Intergenic
943060586 2:183038297-183038319 TGCCGGGGCGCGGGCTGCTGCGG - Exonic
944871873 2:203920142-203920164 TGCCTGAGCCCCGGGGGCAGAGG + Intergenic
945253387 2:207783472-207783494 TGCCTGAGCTCAGGAGGCTGAGG + Intergenic
948382233 2:237558866-237558888 TGCAGCAGCCACGGGGGCTGGGG + Intergenic
948571586 2:238921014-238921036 TGCAGGAGTGCTGGGGGCTGGGG + Intergenic
948825484 2:240571756-240571778 TGCCTGGAGGCCGGGGGCTGCGG - Intronic
948994717 2:241572560-241572582 TTCCGGAGGGCCTGGGTCTGCGG - Exonic
949004581 2:241637843-241637865 GGCCGGGGCGGCGGGCGCTGCGG + Intronic
949014565 2:241702155-241702177 GCCCGGCGCGCGGGGGGCTGCGG - Intronic
1168777732 20:462238-462260 CGCCGGAGGGGCGCGGGCTGGGG - Intronic
1168854952 20:1002009-1002031 GGCCGGAGGACCGGGGGCGGCGG - Intronic
1169192948 20:3669411-3669433 AGCAGGAGCCCCTGGGGCTGGGG + Intronic
1169194006 20:3673780-3673802 TGCAGTGGCGCCGGGGGCTGTGG - Exonic
1171187140 20:23130511-23130533 TGGATGAGTGCCGGGGGCTGTGG - Intergenic
1171402315 20:24882788-24882810 TGCCACAGGGCTGGGGGCTGGGG - Intergenic
1171420493 20:25014265-25014287 TGCCAGAGCTCCTGGGGCTGAGG - Intronic
1171989056 20:31681555-31681577 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1172010689 20:31844271-31844293 TGCCTGATGGCTGGGGGCTGAGG - Intergenic
1172951217 20:38724502-38724524 TGGCGGAGCGGCGGCGGCGGCGG - Exonic
1173868568 20:46328371-46328393 TGCCGGCCCGCCCTGGGCTGGGG + Intergenic
1174339001 20:49884428-49884450 TGCCGCAGCCATGGGGGCTGTGG + Intronic
1174494848 20:50931760-50931782 GGCCGCAGCGCCGGCGGCGGAGG + Intergenic
1174543332 20:51306732-51306754 TGCCTGAGCACCGTGGCCTGAGG - Intergenic
1175036295 20:56004282-56004304 TGCAGGAGCGACGGCGGCGGCGG + Exonic
1175321239 20:58089905-58089927 TGCTTGAGCCCAGGGGGCTGAGG - Intergenic
1175414919 20:58794903-58794925 TGCAGGACAGCCGCGGGCTGGGG - Intergenic
1176048033 20:63102742-63102764 GGCGCGAGCGCCGTGGGCTGGGG + Intergenic
1176048101 20:63102936-63102958 TGCCGGGGCGCAGGGGCCCGCGG + Intergenic
1176414629 21:6467569-6467591 TGGCGGAGAGGCGGGGGCGGAGG + Intergenic
1176953617 21:15074161-15074183 TGCCTGAGCCCCAGAGGCTGAGG - Intergenic
1178329131 21:31671970-31671992 TGCTGGGGCGCCTGCGGCTGTGG + Exonic
1178992576 21:37367524-37367546 TGCCGGGGCGGCGCTGGCTGCGG + Intronic
1179288303 21:39996833-39996855 TGCAGGAGCACCGTGGGATGGGG - Intergenic
1179690127 21:43075891-43075913 TGGCGGAGAGGCGGGGGCGGAGG + Exonic
1179730038 21:43362543-43362565 TCCCGGAGCGCGGCTGGCTGAGG - Intergenic
1179840033 21:44066295-44066317 TCCAGGGGCGACGGGGGCTGAGG + Intronic
1179918024 21:44490565-44490587 TGCCGGCGTGCCAGGGTCTGTGG - Intergenic
1179923979 21:44522422-44522444 TGCTGGAGAGCCGTGGGCAGCGG - Intronic
1180631360 22:17232454-17232476 GGCCGGTGCGGCGGGGGCGGGGG - Intergenic
1180831899 22:18910864-18910886 TGCCGTGGGGCCGGGGGCGGCGG - Intronic
1180960681 22:19761034-19761056 GCCCGGGGCGCCGGGGGCGGCGG - Exonic
1181021313 22:20104835-20104857 TGCTGGAGCGGCGAGGGCAGAGG + Intronic
1181612728 22:24029466-24029488 TGCCTGAGCCCAGGAGGCTGAGG + Intronic
1182354702 22:29717376-29717398 TGCCGAAGGGCGGGGGGCGGTGG + Intergenic
1182467509 22:30526341-30526363 TGCTGGAGCCCTGGGAGCTGAGG - Intronic
1182692899 22:32176161-32176183 TGGCGGAGCGGCGGCGGCGGCGG - Intergenic
1183926992 22:41213407-41213429 TGCCTGAGCCCAGGAGGCTGAGG - Intronic
1184265463 22:43343629-43343651 GGCCGGGGCGCCGCGGGCAGGGG - Intergenic
1184405173 22:44296796-44296818 TGTCCGAGAGCCGGGGGCAGTGG + Exonic
1184645070 22:45891104-45891126 TACGGGAGAGCCCGGGGCTGCGG - Intergenic
1185177144 22:49334408-49334430 TGGCGGAGGGCGGGGGGCGGGGG - Intergenic
1185268642 22:49918386-49918408 GGCCGTAGCGGCCGGGGCTGCGG - Exonic
1203281977 22_KI270734v1_random:136135-136157 TGCCGTGGGGCCGGGGGCGGCGG - Intergenic
950345904 3:12292805-12292827 TGCGTGGGCCCCGGGGGCTGAGG + Intronic
950463933 3:13142201-13142223 TGTCAGAGCGCAGCGGGCTGCGG + Intergenic
951417947 3:22448045-22448067 TGCCGGTGGGCCGGGCGCGGTGG - Intergenic
952882642 3:37994332-37994354 TGCGGAAGCGCAGGGCGCTGCGG + Exonic
954539721 3:51385398-51385420 TGCCGGGCAGCCGGGCGCTGCGG + Exonic
960935920 3:122902498-122902520 TGCCTGAGCCCTGGAGGCTGAGG + Intergenic
961305164 3:125953792-125953814 TGAAGGAGGGCGGGGGGCTGGGG + Intergenic
962312035 3:134333635-134333657 TGCCAGAGAGCCCTGGGCTGCGG - Intergenic
962738774 3:138348362-138348384 CGCTAGAGCGCCAGGGGCTGGGG - Intronic
963213956 3:142724297-142724319 GGCCGGGGCGCCGGCGGCTGGGG + Exonic
963904561 3:150763030-150763052 GCTCGGAACGCCGGGGGCTGCGG - Exonic
964801680 3:160565175-160565197 CGCCGGAGGGGTGGGGGCTGTGG - Intronic
966181888 3:177196531-177196553 GGCCGGCGTGCTGGGGGCTGCGG - Intronic
966372884 3:179266818-179266840 TGCAGCTGCGCTGGGGGCTGGGG - Intronic
966956335 3:184884218-184884240 TGTCGGCGGGTCGGGGGCTGGGG - Intronic
967055642 3:185826157-185826179 GGCCGGAGCGCTGGGGTCAGCGG + Intergenic
968505095 4:967843-967865 GGCCGGGGCGCCCTGGGCTGGGG - Intronic
968602848 4:1518495-1518517 TGAGGGGTCGCCGGGGGCTGCGG + Intergenic
969285503 4:6199934-6199956 TGAAGGAGAGCTGGGGGCTGGGG + Intronic
969322961 4:6424149-6424171 AGCTGGAGCTCCAGGGGCTGAGG - Intronic
969392385 4:6900541-6900563 GGCCTGAGCTCCGGGGGCGGAGG + Intergenic
969725277 4:8914825-8914847 GGCCGGTGTGCCGTGGGCTGTGG + Intergenic
972725859 4:41746070-41746092 GGCTGGAGCTCCGGGGGCGGCGG - Exonic
972932956 4:44097688-44097710 TGTCGGAGGGTCGGGGGCTGGGG + Intergenic
973760338 4:54109382-54109404 TGCCGAAGCTCCGGGGGCCCCGG - Intronic
975342639 4:73258803-73258825 TGGCGGAGCGGCGGCGGCGGCGG - Intergenic
976812322 4:89110942-89110964 TGCCGAGGCGCGGCGGGCTGCGG - Intronic
977920202 4:102634751-102634773 TGGCGGAGGGCAGGGGACTGTGG - Intronic
985768586 5:1795153-1795175 TGCCGGACCGGTGGGGGCTGGGG - Intergenic
986338864 5:6773849-6773871 TGGGGGAGCGGCGGGGGGTGAGG - Intergenic
986338950 5:6774076-6774098 TGAGGGAGCGGCGGGGGGTGTGG - Intergenic
991687160 5:69191967-69191989 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
992032846 5:72740560-72740582 TGCCGGAGCCTCGGGGGAGGAGG - Intergenic
992910724 5:81393923-81393945 TGCGGGAGCGGCGGCGGCTGGGG - Intronic
993901022 5:93584509-93584531 GGGCGCAGCGCCGGGGGCGGCGG - Exonic
994107324 5:95961740-95961762 AGCCGGAGCGGCGGCGGCGGCGG - Exonic
994353153 5:98769334-98769356 TGCTGGGGTGCGGGGGGCTGAGG + Exonic
994525435 5:100900860-100900882 TGCCAGAGCGCCGGCGGCGAGGG - Intronic
995536475 5:113141515-113141537 TGCTGGAGTGCTGAGGGCTGGGG + Intronic
997416522 5:133732719-133732741 TGCCGGAGGGCCTGGACCTGTGG - Intergenic
997500741 5:134371520-134371542 GGCCGCCGCGCCGGGGGGTGGGG + Exonic
997578902 5:135005014-135005036 GGGCGGAGGGCAGGGGGCTGAGG + Intronic
997829866 5:137140553-137140575 GGCAGGAAGGCCGGGGGCTGGGG - Intronic
999727164 5:154446421-154446443 AGGCGGAGGGCCGGGGGCCGAGG + Exonic
1001139737 5:169134595-169134617 TGTCGGAGGGCTGGGGGCTGGGG + Intronic
1001645069 5:173274310-173274332 TGCCTGAGCCCAGGGGGCAGAGG + Intergenic
1002279253 5:178121102-178121124 TGGAGGAGCGCCAGCGGCTGTGG + Exonic
1002991768 6:2245377-2245399 CCCCGGAGCCCCGGGCGCTGGGG + Exonic
1002991770 6:2245379-2245401 TGCCCCAGCGCCCGGGGCTCCGG - Exonic
1003624150 6:7727259-7727281 TGCCGGAGCGCCGGGGGCTGCGG - Exonic
1004199610 6:13535652-13535674 TGCAGGGGCGGCGGGGGCAGGGG - Intergenic
1004203865 6:13574204-13574226 TGCCGGAGACCCGGGCGCCGTGG - Intergenic
1005204845 6:23390749-23390771 TGCCTGAGCCCAGGAGGCTGAGG + Intergenic
1006414402 6:33894974-33894996 TGCCGGGGGGTCGGGGGGTGGGG - Intergenic
1006431622 6:34000686-34000708 TGAGGGAGCACAGGGGGCTGAGG + Intergenic
1006665530 6:35690179-35690201 TGCCTGGGCGCCGGGCGCGGTGG + Intronic
1007751271 6:44073415-44073437 AGCCGGAGCGGCGCGGGCGGGGG - Intergenic
1012400118 6:98835588-98835610 TGCGGGGGCGGCGGGGGCGGCGG - Exonic
1013099489 6:106974888-106974910 GGCCGGAGCGGCGGTGGCAGTGG - Intronic
1013437176 6:110122029-110122051 TGTCGGAGGGTCGGGGGCTGGGG + Intronic
1015251832 6:131135534-131135556 TGCCGCTGCCGCGGGGGCTGCGG + Intergenic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1017738126 6:157381649-157381671 GGCCGGGGAGCCGGGGGCTGCGG + Exonic
1018761731 6:166899381-166899403 TGGCGGGGCGGCGGGGGGTGTGG + Intronic
1019103305 6:169649595-169649617 TGTGGGAGCCCCGGGGGATGAGG - Intronic
1019314250 7:377235-377257 AGCCGGGGCGCCTGGGGCAGTGG + Intergenic
1019417245 7:933476-933498 TGCTGGAGAGCCGGGGGCCGGGG + Intronic
1019417256 7:933506-933528 TGCTGGAGAGCCGGGGGCCGGGG + Intronic
1019417272 7:933543-933565 TGCTGGAGAGCCGGGGGCCGGGG + Intronic
1019417292 7:933603-933625 TGCTGGAGAGCCGGGGACCGGGG + Intronic
1019417303 7:933633-933655 TGCTGGAGAGCCGGGGGCCGGGG + Intronic
1019417314 7:933663-933685 TGCTGGAGAGCCGGGGGCCGGGG + Intronic
1019417325 7:933693-933715 TGCTGGAGAGCCGGGGGCCGGGG + Intronic
1019417345 7:933753-933775 TGCTGGAGAGCCGGGGACCGGGG + Intronic
1019417356 7:933783-933805 TGCTGGAGAGCCGGGGGCCGGGG + Intronic
1019417386 7:933873-933895 TGCTGGAGAGCCGGGGACCGGGG + Intronic
1019417397 7:933903-933925 TGCTGGAGAGCCGGGGGCCGGGG + Intronic
1019417418 7:933963-933985 TGCTGGAGAGCCGGGGGCCGGGG + Intronic
1019417429 7:933993-934015 TGCTGGAGAGCCGGGGGCCGGGG + Intronic
1019417449 7:934053-934075 TGCTGGAGAGCCGGGGACTGGGG + Intronic
1019417457 7:934083-934105 TGCTGGAGAGCCGGGAGCCGGGG + Intronic
1019417468 7:934113-934135 TGCTGGAGAGCCGGGGGCCGGGG + Intronic
1019417489 7:934173-934195 TGCTGGAGAGCCGGGGGCCGGGG + Intronic
1019417500 7:934203-934225 TGCTGGAGAGCCGGGGGCCGGGG + Intronic
1019417520 7:934263-934285 TGCTGGAGAGCCGGGGACTGGGG + Intronic
1019417528 7:934293-934315 TGCTGGAGAGCCGGGAGCCGGGG + Intronic
1019572574 7:1719859-1719881 TGCCTGAGTGCCAGTGGCTGGGG - Intronic
1019639776 7:2097173-2097195 TGCCTGGGCGCCGTGGGGTGGGG - Intronic
1020105483 7:5420560-5420582 TTACCGAGCGCCGGGGGATGCGG - Intronic
1020963726 7:14839483-14839505 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
1023805343 7:43869249-43869271 GGCCGGGGGGCCGGGGGCCGGGG - Intronic
1025836156 7:65095601-65095623 TGCTGGAGCCCGGGGGGCAGAGG - Intergenic
1025982209 7:66415818-66415840 TGCCTGAGCCCCGGAGGTTGAGG - Intronic
1026822282 7:73557585-73557607 GGCGGGAGCGGCGGGGGCCGGGG + Exonic
1027653205 7:80897023-80897045 CGCCGGAGAGCATGGGGCTGTGG + Intronic
1029670093 7:102024180-102024202 TGGAGGAGAGCAGGGGGCTGGGG - Intronic
1030033446 7:105388928-105388950 TGCTGGAGCGGCGGCGGCGGCGG - Intronic
1030065460 7:105655780-105655802 TCCCGGAGCAACTGGGGCTGAGG - Intronic
1030125884 7:106152039-106152061 TGCCGGCGAGCCTGGGGATGAGG - Intergenic
1030929396 7:115503598-115503620 TGCTTGAGCGCAGGAGGCTGAGG + Intergenic
1033299809 7:140176333-140176355 GGCCGGAGCCCCGGGCGCGGCGG + Intronic
1033299993 7:140176913-140176935 GGCCGGAGCGGCGGCGGCGGTGG - Exonic
1033361028 7:140639266-140639288 TGCTTGAACTCCGGGGGCTGAGG + Intronic
1034281274 7:149856093-149856115 TGGCTGAGGGCCAGGGGCTGTGG - Intronic
1035013298 7:155740003-155740025 TGCCGGAGCCCCTGGCGCTGGGG - Exonic
1035021781 7:155804766-155804788 GGGCGGAGCGCAGGGGGCCGGGG + Intronic
1035375525 7:158404709-158404731 GGCCGGAGAGCTGGGGGCCGGGG - Intronic
1035375547 7:158404768-158404790 GGCCGGAGAGCTGGGGGCCGGGG - Intronic
1035580792 8:738094-738116 TGCGGGAGCGCACGGGGCCGCGG + Intronic
1036307346 8:7611713-7611735 TCCGGGAGTGCCGGGGGCTCGGG + Intergenic
1036358190 8:8059697-8059719 TCCGGGAGTGCCGGGGGCTCGGG + Intergenic
1036549653 8:9805165-9805187 TGAAGGAGCCCCGGGAGCTGTGG - Intergenic
1036892760 8:12607246-12607268 TCCGGGAGTGCCGGGGGCTCGGG - Intergenic
1036916321 8:12807270-12807292 TGCCTGAGCCCAGGAGGCTGAGG + Intergenic
1039353947 8:36794843-36794865 TGCCTGAGCCCAGGAGGCTGAGG + Intronic
1039455021 8:37700374-37700396 TGCCGGAGCCCTTGGTGCTGGGG - Intergenic
1039979190 8:42392043-42392065 TACCGGGGCGCGGGGGGCCGGGG + Intronic
1042085130 8:65099035-65099057 TGCCGGGGGGTCGGGGGCTAGGG + Intergenic
1042883716 8:73523961-73523983 TGCCTGAGCCCAGGAGGCTGAGG + Intronic
1043463893 8:80486694-80486716 GACCGGAACGCCGGGGGCGGGGG + Exonic
1044340421 8:91040753-91040775 TGCGGCAGCGGCGGGGCCTGGGG + Exonic
1044662110 8:94601599-94601621 TGCCTGAGCCCCGGAGGCAGAGG - Intergenic
1046547319 8:115668500-115668522 GGCCGCGGGGCCGGGGGCTGCGG - Intronic
1047283502 8:123466080-123466102 TGCCAGAGAACCAGGGGCTGAGG + Intronic
1048442874 8:134472756-134472778 TGCAGGAGCCCCAGAGGCTGGGG - Intergenic
1049203716 8:141353759-141353781 AGCTGGAGGGCAGGGGGCTGGGG - Intergenic
1049443510 8:142619698-142619720 TCCCGCAGCCCCAGGGGCTGGGG - Intergenic
1049721184 8:144116213-144116235 TGCAGGAGCCGCGGGGGCAGCGG - Exonic
1049746897 8:144266785-144266807 GGCCGGCGGGCCGGGGGCGGGGG + Exonic
1049762557 8:144337774-144337796 TGGCGGGGCGCCGGGCGCGGGGG + Intergenic
1049958053 9:711486-711508 TCCCTGAGCTCAGGGGGCTGTGG - Exonic
1051184915 9:14450115-14450137 TGTCGGAGTGTAGGGGGCTGGGG - Intergenic
1052295463 9:26892567-26892589 TGCGGGAGCGCCGGGGGCTGCGG - Exonic
1053151844 9:35748795-35748817 TCCCGGAGGGCCGGGCGTTGGGG + Exonic
1053488272 9:38478461-38478483 TGCCGGAGCCACGGAGGATGAGG + Intergenic
1054109889 9:61096879-61096901 TGGCGGAGCGCTGAGGGCAGCGG - Intergenic
1054610968 9:67234246-67234268 TGGCGGAGCGCTGAGGGCAGCGG + Intergenic
1056799482 9:89681385-89681407 TGCCGGGGGGCCGGGGGGCGGGG - Intergenic
1057208114 9:93185122-93185144 TGCAGGGGCTGCGGGGGCTGCGG - Exonic
1057217231 9:93235826-93235848 TGCAGGTGCACCAGGGGCTGTGG + Intronic
1057330192 9:94107035-94107057 TGCCGGAGCCCAGGAGGCAGAGG - Intronic
1057468932 9:95340479-95340501 TGCTGGAGCCCAGGAGGCTGAGG + Intergenic
1058696361 9:107562510-107562532 TGCTGGAGCCCAGGAGGCTGAGG - Intergenic
1059216493 9:112568802-112568824 TACCGGAGCCCAGGGGGCAGAGG + Intronic
1060267585 9:122121386-122121408 TGCTGGAGCCCAAGGGGCTGGGG - Intergenic
1060694820 9:125699714-125699736 TGCTTGAGCCCAGGGGGCTGAGG - Intronic
1060943534 9:127556991-127557013 TGCCGGAGCCCGGGAGGTTGAGG + Intronic
1062353255 9:136149283-136149305 GGGAGGAGGGCCGGGGGCTGGGG - Intergenic
1062569343 9:137177882-137177904 TCCAGGAGCTCCGGGGCCTGTGG - Intronic
1185761809 X:2694142-2694164 TGCCGTTGCCCCGGGGGGTGGGG - Intronic
1187415754 X:19092120-19092142 TGGCAGAGGGCCGGTGGCTGTGG - Intronic
1189281277 X:39821444-39821466 AGGCGGGGCGCCGGGGGCTGAGG + Intergenic
1189323039 X:40097648-40097670 TGCCCGAGCGCGGGCGGCGGCGG - Intronic
1189332569 X:40152699-40152721 TGCAGGAGTGCGGGGTGCTGCGG + Intronic
1189821440 X:44873247-44873269 GGCCGGAGCGCGCGGGGCTGGGG - Intronic
1195615583 X:106909534-106909556 AGCCGGAGCCCCTGGGGTTGAGG + Intronic
1199760305 X:150899335-150899357 AGCCGAAGCGCCGCGGGCTCGGG + Intergenic