ID: 1003626853

View in Genome Browser
Species Human (GRCh38)
Location 6:7748894-7748916
Sequence CCTAATCCTGGAATCAGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003626846_1003626853 23 Left 1003626846 6:7748848-7748870 CCCCCATCTCTAGGATTGTGAAT 0: 1
1: 0
2: 0
3: 20
4: 154
Right 1003626853 6:7748894-7748916 CCTAATCCTGGAATCAGTAGAGG No data
1003626848_1003626853 21 Left 1003626848 6:7748850-7748872 CCCATCTCTAGGATTGTGAATTT 0: 1
1: 0
2: 1
3: 23
4: 249
Right 1003626853 6:7748894-7748916 CCTAATCCTGGAATCAGTAGAGG No data
1003626850_1003626853 -2 Left 1003626850 6:7748873-7748895 CCTGCTATGTTATGATGATGTCC 0: 1
1: 0
2: 1
3: 11
4: 100
Right 1003626853 6:7748894-7748916 CCTAATCCTGGAATCAGTAGAGG No data
1003626847_1003626853 22 Left 1003626847 6:7748849-7748871 CCCCATCTCTAGGATTGTGAATT 0: 1
1: 0
2: 2
3: 31
4: 406
Right 1003626853 6:7748894-7748916 CCTAATCCTGGAATCAGTAGAGG No data
1003626845_1003626853 28 Left 1003626845 6:7748843-7748865 CCATACCCCCATCTCTAGGATTG 0: 1
1: 0
2: 1
3: 11
4: 176
Right 1003626853 6:7748894-7748916 CCTAATCCTGGAATCAGTAGAGG No data
1003626849_1003626853 20 Left 1003626849 6:7748851-7748873 CCATCTCTAGGATTGTGAATTTC 0: 1
1: 0
2: 3
3: 24
4: 221
Right 1003626853 6:7748894-7748916 CCTAATCCTGGAATCAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003626853 Original CRISPR CCTAATCCTGGAATCAGTAG AGG Intronic
No off target data available for this crispr