ID: 1003630122

View in Genome Browser
Species Human (GRCh38)
Location 6:7779221-7779243
Sequence GCACCATGGTTGCCTGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003630122_1003630132 21 Left 1003630122 6:7779221-7779243 CCAGTGCCAGGCAACCATGGTGC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1003630132 6:7779265-7779287 ATCAGCTCCACTCTACACCTGGG 0: 1
1: 0
2: 0
3: 14
4: 114
1003630122_1003630133 24 Left 1003630122 6:7779221-7779243 CCAGTGCCAGGCAACCATGGTGC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1003630133 6:7779268-7779290 AGCTCCACTCTACACCTGGGTGG 0: 1
1: 0
2: 2
3: 8
4: 119
1003630122_1003630131 20 Left 1003630122 6:7779221-7779243 CCAGTGCCAGGCAACCATGGTGC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1003630131 6:7779264-7779286 TATCAGCTCCACTCTACACCTGG 0: 1
1: 0
2: 1
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003630122 Original CRISPR GCACCATGGTTGCCTGGCAC TGG (reversed) Intronic
900624882 1:3603550-3603572 GCACCAGGTATGCCTGGCCCTGG - Intronic
901165565 1:7219355-7219377 CCGCCATGCTTACCTGGCACGGG + Intronic
902254145 1:15176660-15176682 GCATCATTGGTGCCTGGTACAGG + Intronic
902610306 1:17593217-17593239 GCACCATCTCTGCCAGGCACTGG - Intronic
903302195 1:22387081-22387103 GATCCGTGGTTGCCTGGGACTGG + Intergenic
903500487 1:23797691-23797713 TCACCTTGTCTGCCTGGCACAGG + Exonic
904613360 1:31737021-31737043 GCACCATGCATGCCAGGCACAGG - Intronic
905258722 1:36702587-36702609 GCACCCTGGTTCCCTGACGCTGG + Intergenic
905338029 1:37258627-37258649 GCCCCATGGGTGCCTGGAATTGG - Intergenic
905549952 1:38829620-38829642 GCAGTAGGGGTGCCTGGCACAGG - Intergenic
907743828 1:57192652-57192674 GCACCATGGCAGCCTTTCACTGG + Intronic
908028127 1:59972292-59972314 GCAGCATGGTGTCCTGGCAGAGG - Intergenic
908907112 1:69028836-69028858 GCAGCATGTTTGCCTGGGATTGG + Intergenic
910817609 1:91308834-91308856 TCACCATGTTTGCCTGACAGAGG - Intronic
919380661 1:196856458-196856480 GCACCGTGCTTGCCTTGCAAGGG - Intronic
1063770460 10:9192893-9192915 GAATCATGGTTGCCAGGGACGGG + Intergenic
1064989193 10:21241321-21241343 GCCCCCTGGTGGCCTGGCTCAGG - Intergenic
1067567282 10:47348547-47348569 GCACCAGGCTTGGCTGGAACAGG - Exonic
1069567757 10:69474864-69474886 GCACCCTGGATGTCTGGCCCTGG - Intronic
1070286420 10:75087103-75087125 GCACGATGGGTGCCTTGCACAGG + Intergenic
1071480972 10:86064695-86064717 GCATCATGGTTGCTGGGTACTGG - Intronic
1072797287 10:98365791-98365813 ACACCAGGGCTGTCTGGCACTGG - Intergenic
1075675775 10:124294896-124294918 CCACCCTGCTTGGCTGGCACAGG + Intergenic
1076875153 10:133212344-133212366 GCAGCAGGGCTGCCTGGGACCGG - Intronic
1078012640 11:7584867-7584889 GAACCATAGCTGCCAGGCACAGG - Intronic
1079247015 11:18760143-18760165 GCTCCATGCTTGCCAGGCACTGG - Intronic
1079791699 11:24747634-24747656 GCACCCTGGTAGCCTGGTAGTGG - Intronic
1083367596 11:62150836-62150858 GTACCATGGGTGCCTTGCAGTGG + Intronic
1083815085 11:65128184-65128206 TCCCCATGGCTGCCTGGGACTGG + Exonic
1084432265 11:69117652-69117674 GCACGAAGGGTGCCTGGCTCAGG + Intergenic
1086203159 11:84227598-84227620 GCACCAACTCTGCCTGGCACAGG - Intronic
1086845343 11:91743043-91743065 GCACCTGTGTTGCCTGTCACAGG + Intergenic
1091351984 11:134905197-134905219 CCACCATTGTTGCCTGGCATTGG - Intergenic
1096522569 12:52192423-52192445 GCACCGTGCCAGCCTGGCACTGG + Intergenic
1103505338 12:121439230-121439252 ACACCCTGGTTGTCAGGCACCGG + Intronic
1103533645 12:121619988-121620010 GCACCAGGGCTGGCTGGCAGAGG + Intergenic
1110404676 13:75136552-75136574 GCTCCAGGGTTGCCTGGCTCTGG - Intergenic
1112441512 13:99427453-99427475 GCCCCATGATTGGCTAGCACAGG - Intergenic
1114107275 14:19438746-19438768 CCCCCATGGGTGACTGGCACTGG + Intergenic
1117906909 14:60599029-60599051 GAATGATGGTTGCCAGGCACTGG - Intergenic
1118320479 14:64749525-64749547 CCACCATTGTTGCCTGGCCCGGG - Exonic
1118473461 14:66095379-66095401 GCTCAATGGCAGCCTGGCACAGG + Intergenic
1120369660 14:83616859-83616881 GTATCATGGTTGACTGGCCCGGG + Intergenic
1121262920 14:92579694-92579716 GAAACATGTGTGCCTGGCACTGG + Intronic
1121287602 14:92748488-92748510 CCACCACGGTCGCCTGCCACAGG - Exonic
1122772353 14:104103044-104103066 GCACAGTGGGTGCCTGGCAAGGG + Intronic
1122930809 14:104932384-104932406 GCCCCAGGGTGGCCAGGCACGGG + Intronic
1125679450 15:41521846-41521868 GCAGCATGGGTGGCTGGCAGTGG + Exonic
1125720481 15:41842804-41842826 GCTCCCCGGGTGCCTGGCACTGG - Intronic
1125766553 15:42140502-42140524 TCACCATGGCTGCCTGTCACAGG - Exonic
1127454955 15:59148585-59148607 GCACCATGTCTGCCTGGGCCAGG + Intronic
1128302060 15:66572242-66572264 GCTCCCTGATGGCCTGGCACAGG + Intergenic
1131273569 15:90961466-90961488 TCCCCAAGGTTGCCTGGCTCTGG + Intronic
1132622785 16:875665-875687 GCTCCGTGGCTGCCTGGCAGTGG - Intronic
1132997867 16:2832642-2832664 TCACCAGGCTCGCCTGGCACTGG + Intronic
1133445269 16:5854348-5854370 GAATGATGGTTGCCAGGCACCGG - Intergenic
1135052407 16:19203710-19203732 GCAGCACCTTTGCCTGGCACAGG + Intronic
1137060800 16:35790538-35790560 ACACCACTGTTGCCTGGCAATGG - Intergenic
1137499350 16:48998384-48998406 CCACCATGGCTGCCTGCCTCTGG + Intergenic
1140510490 16:75504067-75504089 GCCACATGGATGCCTGGCAGAGG + Intergenic
1140516249 16:75544382-75544404 GCCACATGGATGCCTGGCAGAGG + Intronic
1140656214 16:77142909-77142931 ACACCAGAGTTGCCTGGCATTGG + Intergenic
1140891642 16:79290052-79290074 TCACCATGTTGGCCAGGCACTGG + Intergenic
1140988438 16:80183561-80183583 GAATGATGGTTGCCTGGGACTGG + Intergenic
1143388929 17:6548776-6548798 ACACCGTGTTTGCCTGGCTCTGG - Intronic
1143867896 17:9937392-9937414 GCACAGTGGTTGCAGGGCACGGG + Intronic
1145110793 17:20159398-20159420 CCTCCATGGTTGACTGCCACAGG + Intronic
1148139265 17:45316910-45316932 GCTCCCTGGTCGCCTCGCACCGG + Intronic
1148585980 17:48780664-48780686 GAATCATGGTTGCCAGGGACTGG - Intronic
1153508561 18:5828975-5828997 TCACCAGGGGTCCCTGGCACTGG + Intergenic
1153654563 18:7271492-7271514 ACACTATGGTTCCCTGGCACAGG + Intergenic
1157413009 18:47479609-47479631 GCACCATGCTTGGCAGGCAGAGG + Intergenic
1160922647 19:1528228-1528250 GCACCTGGGTTACCTGGGACAGG - Intronic
1161607293 19:5222262-5222284 GCCCCATGAGTGCCTGGCACTGG + Intronic
1162110132 19:8395592-8395614 TCACCATGGGTGCCCCGCACAGG - Intronic
1162809693 19:13156200-13156222 GCCCCACGGTGGCCGGGCACCGG - Intergenic
1163985528 19:20944347-20944369 GCTACATGGTTGCCAGGCAGTGG - Intronic
1165663548 19:37604816-37604838 GCAACTTAGTTGCCTGTCACGGG - Intronic
1167050717 19:47076426-47076448 GATCCACGGTTGCCAGGCACTGG + Intronic
1167499511 19:49837204-49837226 GCACCATGGGAGCCTGGAAGAGG + Intronic
1167504988 19:49866605-49866627 GCACTAGGATTGCCTGACACTGG + Intronic
926132278 2:10311245-10311267 GCAGCCTGGATGCCTGGCAGGGG + Intronic
926656815 2:15416606-15416628 TCACCATGTTGGCCAGGCACTGG - Intronic
927450364 2:23204454-23204476 GCCCCATGATGGCCTGTCACAGG - Intergenic
927719428 2:25373290-25373312 GGGCCATGGGTGCCTGGCACAGG + Intergenic
933416944 2:81998370-81998392 GGCCAATGGTTGCCTGGCAAAGG - Intergenic
933722528 2:85407423-85407445 CCACCATGCCTGGCTGGCACTGG - Intronic
934234342 2:90216958-90216980 GCCACATGGCTGCCTGGCAGGGG - Intergenic
938296360 2:130181954-130181976 GCCCAATGTATGCCTGGCACTGG + Exonic
938460389 2:131492684-131492706 GCCCAATGTATGCCTGGCACTGG - Intronic
938626975 2:133121121-133121143 GCACCATGTTTTTCTGGCATCGG - Intronic
939987187 2:148841281-148841303 GAATCATGGTTGCCAGGTACTGG - Intergenic
940928495 2:159396149-159396171 GCATAATGGTTGGCTGGAACAGG + Intronic
944264135 2:197705815-197705837 GCACCACGGAGGCCCGGCACCGG + Exonic
946027735 2:216681979-216682001 GTATCATGGTTGCTTGGCCCCGG - Intronic
947128323 2:226895237-226895259 ACCCCATGGTTGCCTAGCTCAGG - Intronic
947529592 2:230900435-230900457 CCACCCTGTGTGCCTGGCACAGG - Intergenic
949058407 2:241942362-241942384 GCACCATGGCTGCCTGGGCAGGG + Intergenic
1174377475 20:50135735-50135757 GCTCTATGGTTGCATGGAACAGG - Intronic
1175725340 20:61314283-61314305 GAACAATGGTTGCCTGGGGCTGG - Intronic
1176297077 21:5079591-5079613 GCCCCATGGTCTCCTGGCATTGG - Intergenic
1179859951 21:44182356-44182378 GCCCCATGGTCTCCTGGCATTGG + Intergenic
1180212750 21:46305025-46305047 GGACGGTGGTTGCCAGGCACTGG + Intronic
1180947712 22:19705771-19705793 GGACCCTGCCTGCCTGGCACCGG + Intergenic
1180947732 22:19705842-19705864 GGACCCTGTCTGCCTGGCACTGG + Intergenic
1183371168 22:37433363-37433385 GCACCCTGCTTGCCTGGCTGGGG + Intergenic
1183664318 22:39238666-39238688 GCCCCATGGTGGGCTGGAACAGG - Intronic
1185142394 22:49109881-49109903 GTAACATGGTTTCCTGACACTGG + Intergenic
1185306360 22:50119403-50119425 GAGCCAAAGTTGCCTGGCACTGG - Intronic
952974126 3:38679782-38679804 GCACCATGCTTGCCTCACCCTGG + Intergenic
953728131 3:45418780-45418802 GCACCTAGGTAGCCTGGCTCAGG - Intronic
954303341 3:49712971-49712993 GCACCTTGACTCCCTGGCACTGG + Intronic
956534685 3:70262687-70262709 GCACCATGCTTGCCTTGCTTGGG + Intergenic
961313300 3:126017405-126017427 GACCCTTGGTTGCCTGGGACTGG - Intronic
966988542 3:185204635-185204657 GCACCCTGGGTGTCTTGCACAGG - Exonic
970332771 4:15002821-15002843 CCACCACCGTTGCCTGTCACCGG + Exonic
972476391 4:39453996-39454018 GCCTCATGTTTGCCTGTCACTGG + Intergenic
981562708 4:146065035-146065057 GAACCATGGTTGCCAGGGGCTGG + Intergenic
984710564 4:182880766-182880788 GTACCATGGCTGCCTGTGACGGG + Intergenic
985584937 5:725895-725917 GCACCCTGGATGCTTGGCAGGGG + Intronic
985598442 5:810209-810231 GCACCCTGGATGCTTGGCAGGGG + Intronic
987041135 5:14063937-14063959 GAACAATGGTTGCCTGGAGCTGG + Intergenic
987116812 5:14732251-14732273 GCACCATCTGTGCCTGGGACTGG + Intronic
987483962 5:18499311-18499333 GCACAATGTTTTCCTGGAACAGG - Intergenic
987623419 5:20366513-20366535 CCACCATGGTGGCTTGTCACAGG - Intronic
988330028 5:29824664-29824686 GCATCATGGTAGCCCGGCACTGG - Intergenic
988688786 5:33550819-33550841 ACACCATGGATCCCTAGCACAGG + Intronic
990317043 5:54592461-54592483 TCTCAATGGTTGCCTGGCACTGG + Intergenic
998091478 5:139373373-139373395 TCACCATGTTGGCCAGGCACTGG + Intronic
999190304 5:149742230-149742252 CCCCCATGGTTGCCTGGTATAGG - Intronic
1001020668 5:168179851-168179873 GCTTCCTGGGTGCCTGGCACTGG - Intronic
1002704067 5:181148596-181148618 GCACAATAGATGCCAGGCACTGG + Intergenic
1002987970 6:2209877-2209899 CTACCATGGCTGCCAGGCACAGG + Intronic
1003630122 6:7779221-7779243 GCACCATGGTTGCCTGGCACTGG - Intronic
1004050241 6:12070490-12070512 GCACCATGTTGGCCACGCACTGG - Intronic
1006437411 6:34033167-34033189 GCACCAGGGCTGCTTGGCTCAGG + Intronic
1007123131 6:39400151-39400173 GCACCCTGTTTGGCTGTCACAGG + Intronic
1007350855 6:41272472-41272494 GCACCATGGTTCCCAAGGACAGG + Intronic
1011532753 6:88341971-88341993 GCACCATGCTAGCCTGTTACAGG + Intergenic
1024259530 7:47563441-47563463 GCCCCATGGTTGACTAGCTCAGG - Intronic
1024287294 7:47769592-47769614 CCACCTTGGTTTCCTTGCACAGG + Intronic
1025810936 7:64875096-64875118 ACGCCATGGTTGCCTGGCGACGG + Intronic
1026015333 7:66667216-66667238 GCACCCTTAGTGCCTGGCACGGG + Intronic
1026891741 7:73986368-73986390 GCACCCTAAGTGCCTGGCACGGG + Intergenic
1034345455 7:150382670-150382692 GCACCAGGCTTGCCGGACACAGG + Intronic
1035681175 8:1489313-1489335 GCACCATGCGTGGATGGCACCGG + Intergenic
1044386362 8:91593579-91593601 GCAGCATGGTAGCCAGTCACTGG - Intergenic
1045585909 8:103537023-103537045 GCAGCATATTTGCCAGGCACTGG + Intronic
1045795282 8:106036716-106036738 GCACCGTGGTTTCCTGCCTCAGG - Intergenic
1048303353 8:133267098-133267120 GCACGATGGTGGCCTGGGGCTGG - Intronic
1048872607 8:138811903-138811925 TCACCACGGTCACCTGGCACTGG + Exonic
1048987421 8:139742171-139742193 GCACTGTGGTTGCCTGGCTCTGG + Intronic
1049560930 8:143309921-143309943 GCATCATGGGTCCCTGTCACAGG + Intronic
1050064041 9:1739954-1739976 TCACCATGGCTGCCATGCACAGG - Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1056308980 9:85320901-85320923 GCAGCATGGTGGCCTGTCCCTGG - Intergenic
1057700113 9:97357932-97357954 GCTCCATGCTTGCCTGGGAGGGG - Intronic
1058175633 9:101733640-101733662 GCACTATTTTTGCATGGCACAGG - Intronic
1062538559 9:137031577-137031599 TCACCATCCTTGTCTGGCACTGG - Exonic
1187073403 X:15910995-15911017 TGACCATGGTTCCCTGGGACCGG + Intergenic
1187858139 X:23656712-23656734 GCACCAGGGATCCATGGCACTGG - Intergenic
1189717654 X:43882309-43882331 GCACCAGGGAGGCCTGGAACGGG - Exonic