ID: 1003630771

View in Genome Browser
Species Human (GRCh38)
Location 6:7784832-7784854
Sequence CTGTGCAATCCCAAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 320}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003630771_1003630779 17 Left 1003630771 6:7784832-7784854 CCTTCTACCTTGGGATTGCACAG 0: 1
1: 0
2: 2
3: 26
4: 320
Right 1003630779 6:7784872-7784894 GGGCTGCAGAGTTTACGCTGAGG No data
1003630771_1003630773 -5 Left 1003630771 6:7784832-7784854 CCTTCTACCTTGGGATTGCACAG 0: 1
1: 0
2: 2
3: 26
4: 320
Right 1003630773 6:7784850-7784872 CACAGTCACCTCCTCCTTGCTGG 0: 1
1: 0
2: 4
3: 60
4: 849
1003630771_1003630774 -4 Left 1003630771 6:7784832-7784854 CCTTCTACCTTGGGATTGCACAG 0: 1
1: 0
2: 2
3: 26
4: 320
Right 1003630774 6:7784851-7784873 ACAGTCACCTCCTCCTTGCTGGG 0: 1
1: 0
2: 1
3: 27
4: 235
1003630771_1003630780 30 Left 1003630771 6:7784832-7784854 CCTTCTACCTTGGGATTGCACAG 0: 1
1: 0
2: 2
3: 26
4: 320
Right 1003630780 6:7784885-7784907 TACGCTGAGGAAGTGAAAGAAGG 0: 1
1: 0
2: 1
3: 17
4: 203
1003630771_1003630775 -3 Left 1003630771 6:7784832-7784854 CCTTCTACCTTGGGATTGCACAG 0: 1
1: 0
2: 2
3: 26
4: 320
Right 1003630775 6:7784852-7784874 CAGTCACCTCCTCCTTGCTGGGG 0: 1
1: 0
2: 1
3: 32
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003630771 Original CRISPR CTGTGCAATCCCAAGGTAGA AGG (reversed) Intronic
902100905 1:13987939-13987961 CTGTGTCATCCCATGGTAGAAGG + Intergenic
903434669 1:23338062-23338084 CTGTGTTTTCCCAGGGTAGAAGG - Intronic
904141323 1:28355763-28355785 CTGTGAATTCCCAAAGGAGAGGG + Intergenic
904939911 1:34158434-34158456 CAGTGCATTCTCGAGGTAGAGGG + Intronic
907091628 1:51730153-51730175 CTGAGAACTCCCAAGGAAGAGGG - Intronic
907517055 1:54999349-54999371 CAGTGCTACCCCAAGGTAGGTGG + Exonic
907869908 1:58433519-58433541 CTGCGACATCCCATGGTAGAAGG + Intronic
907962064 1:59293391-59293413 CTGTGTCATCCCATGGCAGAAGG + Intergenic
910285240 1:85546328-85546350 CTGTATCATCCCATGGTAGAAGG - Intronic
910993213 1:93077279-93077301 CTTTGAAAGGCCAAGGTAGAAGG - Intergenic
911392746 1:97267513-97267535 CTGTGTCATCCCACGGTGGAAGG + Intronic
912617190 1:111114984-111115006 AGGTGGAATCACAAGGTAGAAGG - Intergenic
916653087 1:166849035-166849057 CTGTGATATCCCGAGGCAGACGG - Exonic
918205747 1:182307643-182307665 CTTTGGAAAGCCAAGGTAGATGG + Intergenic
918929355 1:190834194-190834216 CTGTGTCATTCCATGGTAGAGGG - Intergenic
919344997 1:196363677-196363699 CTGTGTCATCCCATGGCAGAAGG - Intronic
919434386 1:197538920-197538942 CTGTGTCATCCCATGGTGGAAGG - Intronic
919470869 1:197977708-197977730 CTGTGCAGTCCAAAGTCAGATGG + Intergenic
921213773 1:212920723-212920745 CTGTGCTCTCCCAGGGAAGAGGG + Intergenic
921812661 1:219532275-219532297 TTGTGCAATGCCAAGGTTAAGGG - Intergenic
923023203 1:230182519-230182541 CTGGGAAATCCCAAAGTACATGG - Intronic
923180558 1:231514568-231514590 CTGGGGACTCCAAAGGTAGAAGG - Intergenic
1063186305 10:3654877-3654899 CTGTGAAATCCCAAGGTTTCTGG + Intergenic
1063343592 10:5291816-5291838 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1064521849 10:16210794-16210816 CTTTGGGATCCCAAGGTGGAAGG + Intergenic
1067162566 10:43839793-43839815 CTGTATTATCCCAAGGCAGAAGG + Intergenic
1067221936 10:44350469-44350491 CTGTACCATCCCAAGGTAGAGGG + Intergenic
1067777916 10:49176379-49176401 CTGTACAATCCCAGTGAAGAGGG + Intronic
1069412096 10:68164239-68164261 CTGTGCCATTCCATGGCAGAAGG + Intronic
1069590671 10:69639812-69639834 CTGTGGAACCCCCAGGGAGAGGG + Intergenic
1069596125 10:69672033-69672055 CTGTGCCTTCACAAGGTAGAAGG + Intergenic
1069872557 10:71542122-71542144 CTGAGCGATCCCTAGATAGAAGG - Intronic
1069980260 10:72247591-72247613 CTCTGCAATGCCAGGGTAGAAGG + Intergenic
1071569068 10:86686570-86686592 CTGTGAGATGCCAAGGCAGAAGG + Intronic
1071992393 10:91112649-91112671 CTGTGTGATCCCACGGCAGAAGG + Intergenic
1072708511 10:97699736-97699758 CTTTGGAAGCCCAAGGTGGAAGG - Intergenic
1072762489 10:98068441-98068463 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1073375015 10:103026067-103026089 CTGTGTCATCCCATGGCAGAAGG - Intronic
1073583174 10:104685939-104685961 CCGGGCAATCCCAAAGTCGAAGG - Intronic
1073586814 10:104718268-104718290 CTGTGTCATCCCATGGCAGAAGG + Intronic
1074644784 10:115435402-115435424 CTGTGTCATCCCATGGCAGAAGG - Intronic
1075319237 10:121476751-121476773 CTGTGCATTCCCAGGGGACAGGG - Intergenic
1076070147 10:127482622-127482644 CTGTGGAAGCCCAAGGGTGAGGG - Intergenic
1082776912 11:57252512-57252534 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1083469494 11:62873568-62873590 CTTTGCAAGGCCAAGGTAGGAGG - Intronic
1084616886 11:70242454-70242476 CTGTGTCATCCCATGGGAGAAGG + Intergenic
1087329400 11:96760972-96760994 CTGTCTCATCCCAAGGCAGAAGG - Intergenic
1088635899 11:111820366-111820388 CTGTGCCATCTCATGGCAGAAGG + Intronic
1089549017 11:119255976-119255998 CTGTGCAAGGCCAAGGCAGGAGG - Intronic
1089786021 11:120907835-120907857 CTGGGCAAGCAAAAGGTAGAAGG + Intronic
1090345835 11:126069691-126069713 CTGTGGAAGGCCAAGGTAGGTGG + Intergenic
1091294304 11:134462083-134462105 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1091395782 12:153531-153553 CTGTGAAATCCCTAGCTGGAAGG - Intronic
1091408440 12:223596-223618 CTGTGGCATCTCAAGGGAGAAGG - Intronic
1091531375 12:1359502-1359524 CTGTGTCATCCCACGGTGGAAGG + Intronic
1091931490 12:4399284-4399306 CTGTGTTATTCCATGGTAGAAGG + Intergenic
1092736405 12:11587184-11587206 CTGAGCTATCCCAATGTAGGGGG - Intergenic
1093845687 12:23968558-23968580 CTGTGTCATCTCAGGGTAGATGG - Intergenic
1094424508 12:30304512-30304534 CTGCGCAACCACAAGGGAGAGGG + Intergenic
1094542455 12:31373764-31373786 CTGTGCACTCACATGGTGGAAGG - Intergenic
1096534741 12:52264136-52264158 CTGTGCAATCTCCAGGTTGAGGG - Intronic
1097011710 12:55957813-55957835 CTGTGCAAACTTAAAGTAGAAGG - Intronic
1097291805 12:57922946-57922968 CTTTGGAAGGCCAAGGTAGATGG - Intergenic
1097548904 12:61041656-61041678 CTGTGGAATGGAAAGGTAGAGGG - Intergenic
1100020395 12:90062428-90062450 CTTTGCAATGCCAAGGCGGACGG + Intergenic
1100234052 12:92639844-92639866 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1100991330 12:100254568-100254590 CTTTGGAAGCCCAAGGCAGATGG - Intronic
1101104143 12:101423585-101423607 CTGTGTTATCCCATGGTGGAAGG + Intergenic
1101451698 12:104785695-104785717 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1101997293 12:109534375-109534397 CTGTGCAGGCCCCAGGGAGAAGG + Intronic
1102554966 12:113720809-113720831 CTGTGCAGTCCCACGGGGGAGGG - Intergenic
1103118794 12:118362772-118362794 CTTTGGAAGGCCAAGGTAGATGG + Intronic
1103234176 12:119358392-119358414 CTGTGTCATCCCATGGTGGAAGG - Intronic
1104087037 12:125484846-125484868 CTTTGGGAACCCAAGGTAGAAGG - Intronic
1104611445 12:130231852-130231874 CTGTGAGATGCCAAGGCAGAAGG + Intergenic
1105530012 13:21210783-21210805 CTGTGTCATCCCATGGTTGAAGG + Intergenic
1105808226 13:23971497-23971519 CTGTGTCATCCCATGGTAGAAGG - Intergenic
1105934143 13:25083172-25083194 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1106782723 13:33075887-33075909 CTGTGTACTCACATGGTAGAAGG + Intergenic
1106821424 13:33468617-33468639 CTTTGCCATCCCATGGCAGAAGG - Intergenic
1107260546 13:38485418-38485440 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1107880567 13:44828840-44828862 CTGTGTTATCCCATGGTGGAAGG + Intergenic
1108506535 13:51117560-51117582 ATTTCCAAACCCAAGGTAGAAGG + Intergenic
1110487300 13:76061551-76061573 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1112400274 13:99071377-99071399 CTTTGGAAGGCCAAGGTAGATGG - Intronic
1114278079 14:21165887-21165909 CTGTGCTATCCCAGGGAGGAGGG + Intergenic
1114731290 14:24995184-24995206 CTGTGTACTCACATGGTAGAAGG + Intronic
1114834319 14:26185469-26185491 CTGTGCTTTCCCATGGTAAAAGG - Intergenic
1115736698 14:36339316-36339338 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1116868085 14:50047547-50047569 CTGTGAAAGCCCAGGGGAGATGG + Intergenic
1117468021 14:56013792-56013814 CTGTGTCATCTCATGGTAGAAGG - Intergenic
1117539112 14:56729474-56729496 CTGGGAAATTCTAAGGTAGAAGG + Intronic
1118253650 14:64185762-64185784 CTTTGGAAGCCCAAGGTGGACGG - Intronic
1118586039 14:67354018-67354040 CTGTGTTATCCCATGGCAGAAGG - Intronic
1118782563 14:69018671-69018693 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1119604326 14:76001792-76001814 CTGAGTAATCCCATGGCAGAAGG + Intronic
1119620700 14:76130004-76130026 CTGTGCCCTCACAAGGTAGAAGG + Intergenic
1120044590 14:79791698-79791720 CCGTGCAAACCCAAGGAAGAAGG + Intronic
1120402985 14:84055684-84055706 CTGTGCCCTCCCACGGCAGAAGG + Intergenic
1120671463 14:87367058-87367080 CTGTGTCCTCACAAGGTAGAAGG + Intergenic
1121420982 14:93814062-93814084 CTGTGCTATTCCATGGCAGAAGG + Intergenic
1122501545 14:102203487-102203509 CTGTGAAGTCCCAAGCTAAAGGG - Intronic
1125260912 15:37823773-37823795 CTGTGCTCTCCCAAGGTGGAAGG - Intergenic
1125491010 15:40148391-40148413 CTGTATCATCCCATGGTAGAAGG - Intergenic
1126142633 15:45450550-45450572 CTCTGTAATTCCAAGGAAGAAGG + Intergenic
1127255704 15:57290982-57291004 CTGTGGAATGCCAAGGGAGAAGG - Intronic
1127600419 15:60530235-60530257 CTGTGCCATCCCAGGTTATAAGG - Intronic
1127733230 15:61819070-61819092 CTGTGTCATCCCATGGTAGAAGG - Intergenic
1128672271 15:69582768-69582790 CTGTGTCATCTCATGGTAGAAGG + Intergenic
1128733195 15:70034554-70034576 CTGTGCTACCACAAGGTAGAAGG + Intergenic
1128938302 15:71766985-71767007 CTGTGCAATCTGACCGTAGAGGG + Intronic
1130052182 15:80493081-80493103 CTGTGTCATCCCATGGTGGAAGG + Intronic
1130905056 15:88234408-88234430 CTGTGCAGGCCCAAGGAATATGG - Intronic
1133256460 16:4519536-4519558 CTGTGTCATCCCATGGTGGAAGG - Intronic
1134865536 16:17603723-17603745 CTGTGCCCTCACATGGTAGAAGG + Intergenic
1135432619 16:22399134-22399156 CTTTGGAAGGCCAAGGTAGAAGG - Intronic
1135650296 16:24200624-24200646 CTGTGTCATCCCATGGCAGAAGG + Intronic
1136042805 16:27593749-27593771 CTTTGGAAGGCCAAGGTAGAAGG - Intronic
1136468644 16:30463302-30463324 CTGTGTCATCCCACAGTAGAAGG - Intergenic
1138561714 16:57804836-57804858 CTTTGGAAAGCCAAGGTAGAAGG - Intronic
1139260152 16:65584160-65584182 CTGTGCCCTCCCATGGCAGAAGG + Intergenic
1140019128 16:71220317-71220339 TTATGCAATCACAAAGTAGAAGG - Intronic
1140554656 16:75907997-75908019 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1143742373 17:8964145-8964167 CTTTGGAAGGCCAAGGTAGACGG + Intronic
1143868564 17:9941567-9941589 CTATGAGATCCCAAGGTGGATGG + Intronic
1144818814 17:18056506-18056528 CTGTACAGTCCCAGAGTAGAAGG + Intronic
1145415187 17:22708773-22708795 CAGTGCTACCCCAAGGTATATGG + Intergenic
1146323301 17:31863942-31863964 CTTTGGAAGGCCAAGGTAGAAGG - Intronic
1147437699 17:40427723-40427745 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1147570279 17:41566271-41566293 CTGGACAATCCTGAGGTAGAAGG + Intronic
1148699261 17:49578140-49578162 CTGTGAAATCCCCAGGCTGATGG - Intronic
1148891684 17:50812154-50812176 CACTGTAATCCCAAGGCAGAAGG - Intergenic
1149324713 17:55518158-55518180 CTGTGTCATCCCATGGTAGAAGG + Intergenic
1149940181 17:60855924-60855946 CTGTGCAAGGCCAAGGCAGGCGG - Intronic
1150505898 17:65698880-65698902 CAGTGCAAGCCCAGGGAAGAGGG + Intronic
1151274452 17:73023403-73023425 CTGTGGGATTCCAAGGTAGGAGG + Intronic
1151490100 17:74427697-74427719 CTCTCCACTCCCCAGGTAGAGGG + Intronic
1151998937 17:77632592-77632614 CTGTGCCCTCACATGGTAGAAGG - Intergenic
1152126217 17:78448803-78448825 CTGTGTCATCCCATGGTGGAAGG - Intronic
1152507033 17:80756248-80756270 CTGTGCCATCCCATGGCAGAAGG - Intronic
1152769743 17:82160044-82160066 CTGTGCACTCCCTGGGCAGATGG + Intronic
1153674806 18:7447463-7447485 CTGTGCCCTCACATGGTAGAAGG + Intergenic
1153857095 18:9160354-9160376 CTTTGGAAGCCCAAGGTAGGAGG - Intronic
1154505311 18:15033038-15033060 CTGTGTTATCCCATGGTGGAAGG + Intergenic
1156092025 18:33482829-33482851 CTGAGTCATCCCAAGGCAGAAGG + Intergenic
1157555218 18:48609081-48609103 CTGTGGACTCTGAAGGTAGATGG - Intronic
1157924630 18:51749843-51749865 CTGTGTCCTCCCATGGTAGAAGG + Intergenic
1158429840 18:57375447-57375469 CTGTGCTTTCCCATGGTGGAAGG - Intergenic
1158994653 18:62906179-62906201 CTGTGTAATCTCAAGATAAAAGG - Intronic
1160103058 18:75941892-75941914 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1160135481 18:76267582-76267604 CTTTGCAAGGCCAAGGTAGGCGG + Intergenic
1163356795 19:16818058-16818080 CTTTGAAAGGCCAAGGTAGAAGG + Intergenic
1164612067 19:29639306-29639328 CTGTGGGATCTCCAGGTAGATGG - Intergenic
1166774128 19:45302377-45302399 CCGTTTGATCCCAAGGTAGATGG - Exonic
926589616 2:14726428-14726450 CTGTGTTATCCCATGGTGGAAGG + Intergenic
926843792 2:17111041-17111063 CTGTGCCTTCACATGGTAGAAGG + Intergenic
928110828 2:28507385-28507407 CTGTGCCATCCCATGACAGAAGG + Intronic
928600185 2:32896902-32896924 CTGTGCCATCCCAAGGTGGAAGG - Intergenic
929289933 2:40178418-40178440 CTCTCCAATCTCAAGGAAGAAGG + Exonic
929456984 2:42073012-42073034 CTGTGCTATCCCCAGGATGAGGG + Intergenic
930511663 2:52352882-52352904 CTGTGCCATCCCATGGCAGAAGG - Intergenic
931419756 2:62116088-62116110 CTGTGGAAGGCCAAGGCAGATGG - Intronic
931995738 2:67837646-67837668 CTGTGCCTTCACATGGTAGAAGG + Intergenic
932516777 2:72359356-72359378 CTGTGATCTCACAAGGTAGAAGG - Intronic
932639762 2:73432594-73432616 CTGTGCCCTCCCATGGTGGAAGG + Intronic
932790364 2:74649632-74649654 CTGTGTCATCCCATGGCAGAAGG + Intergenic
932797495 2:74709743-74709765 CTGTGTCATCCCATGGCAGAAGG + Intergenic
934690823 2:96357573-96357595 CTGTGAACTCCAGAGGTAGAAGG - Intronic
935417607 2:102835239-102835261 CATTGGAATCCAAAGGTAGAAGG + Intronic
935807749 2:106765778-106765800 CTGTGTCATCTCATGGTAGAAGG + Intergenic
935996407 2:108778971-108778993 CTGTGCAAGGCCAAGGTGGCAGG - Intronic
936053894 2:109246339-109246361 CTGTGTCCTCCCATGGTAGAGGG + Intronic
937315230 2:120927948-120927970 CTTTGAAGTCCCCAGGTAGAAGG + Intronic
937367971 2:121278758-121278780 CTTTGGAAGCCCAAGGTAGGTGG + Intronic
937593320 2:123641768-123641790 CGGTGATATCGCAAGGTAGAAGG + Intergenic
938504498 2:131863300-131863322 CTGTGTTATCCCATGGTGGAAGG + Intergenic
938945874 2:136211632-136211654 CTGTGCCTTCACATGGTAGAAGG + Intergenic
940174730 2:150865448-150865470 CTGTGTCATCCCATGGCAGAAGG + Intergenic
941180740 2:162256182-162256204 CTATATAATCACAAGGTAGAGGG + Intergenic
941527923 2:166628951-166628973 ATGGGCATTCCCAGGGTAGAGGG + Intergenic
943204804 2:184880758-184880780 CTGTGTCATCCCATGGTGGAAGG + Intronic
943539378 2:189193034-189193056 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1168827443 20:823254-823276 CTGTGCCAGCCCTGGGTAGAGGG + Intergenic
1169286930 20:4316824-4316846 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1170014028 20:11760641-11760663 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1170509772 20:17064748-17064770 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1170794625 20:19535908-19535930 CTGTGTCATCCCATGGCAGAAGG + Intronic
1170838740 20:19907003-19907025 CTGGGAAGTCCCAAGGTTGAGGG + Intronic
1173046641 20:39518879-39518901 CTGGGGAATCCCAAGGTTGTGGG + Intergenic
1173138340 20:40459874-40459896 CTTTGGAAGGCCAAGGTAGATGG + Intergenic
1173741036 20:45402182-45402204 CTTTGGAATGCCAAGGCAGATGG - Intronic
1173778537 20:45733601-45733623 CTGTGCTCTCACATGGTAGAAGG + Intergenic
1174267144 20:49340223-49340245 CAGTGCAGTCACAAGCTAGAGGG + Intergenic
1174514967 20:51084639-51084661 GAGTGCAAACCCAAGTTAGACGG - Intergenic
1175212118 20:57366399-57366421 CTGGGGAATCCCAAGGGAGCAGG + Intronic
1176069812 20:63220199-63220221 CAGTGCACTCCCAAGGCACAGGG - Intergenic
1176268973 20:64225602-64225624 GTGTGTATTGCCAAGGTAGAGGG + Intronic
1176378281 21:6097889-6097911 CTGCGGCATCCCAAGGTGGAAGG + Intergenic
1176792540 21:13336062-13336084 CTGTGTTATCCCATGGTGGAAGG - Intergenic
1177991947 21:28046946-28046968 CTGTGTTATCCCATGGTGGAAGG - Intergenic
1178168228 21:30007462-30007484 CTGTGTCATCACACGGTAGAAGG + Intergenic
1178214863 21:30583867-30583889 CTGTACCATCCCATGGCAGAAGG + Intergenic
1179745191 21:43440358-43440380 CTGCGGCATCCCAAGGTGGAAGG - Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180800031 22:18627394-18627416 CTGTGCATCCCCAAGACAGATGG + Intergenic
1181221684 22:21367872-21367894 CTGTGCATCCCCAAGACAGATGG - Intergenic
1182054415 22:27338669-27338691 CTGTGTCATTCCATGGTAGAAGG - Intergenic
949410488 3:3758069-3758091 CTGTGCAATCTCAAGTTAATTGG - Intronic
952847822 3:37702938-37702960 CTGTGCATTCCCCAGGGACAGGG - Intronic
953144366 3:40260845-40260867 CTGTGTCATCCCATGGCAGAAGG + Intergenic
953467039 3:43131170-43131192 CTGTGCTATACCATGGCAGAAGG + Intergenic
953923678 3:46969268-46969290 GGGAGCAATGCCAAGGTAGAAGG - Intronic
954101449 3:48375916-48375938 CTTTGGAAGCCCAAGGTAGGCGG - Intronic
954830960 3:53420945-53420967 CTGTGCAATCACAAGGTTCAGGG + Intergenic
955026919 3:55176639-55176661 CTGTGTCATCCCATGGCAGATGG + Intergenic
955982063 3:64536964-64536986 CTGTGCAATCACTAGGTCAAAGG + Intronic
956299449 3:67754383-67754405 CTTTGCAAAGCCAAGGCAGATGG + Intergenic
957114339 3:76005053-76005075 CTGTGCCATCTCATGGTGGAAGG - Intronic
960677924 3:120214866-120214888 CTCTGCAATCCTAAGGTGGATGG + Intronic
960859391 3:122136061-122136083 CTGTGTCATCCCATGGTGGAAGG + Intergenic
961060177 3:123822084-123822106 CTGTGTCATCCCACGGTGGAAGG - Intronic
964102248 3:153001307-153001329 CTGTGTCATCCCATGGTGGAAGG + Intergenic
964390051 3:156187204-156187226 CTGAGAAATACCAAGGTGGAGGG - Intronic
964495315 3:157282751-157282773 CTGTGCAATTCCAAGACACAAGG + Intronic
966338706 3:178901274-178901296 CTGTGTCATCCCATGGCAGAAGG - Intergenic
967127961 3:186442856-186442878 CTGTGCCCTCCCATGGCAGAAGG + Intergenic
967774912 3:193376330-193376352 CTGTGCCCTCACATGGTAGAAGG + Intronic
968160743 3:196424627-196424649 CTTTGGAATGCCAAGGTGGAAGG - Intronic
970901610 4:21165944-21165966 CTGTGTCCTCCCAAGGTGGAAGG - Intronic
971364863 4:25969570-25969592 CTGTCCAATCAGAAGGGAGATGG + Intergenic
972725097 4:41740432-41740454 CTTTGCAATCCCCAGGAGGAGGG - Intergenic
972847704 4:43009650-43009672 CTGTGTCATCACATGGTAGAAGG + Intronic
973646323 4:52954454-52954476 CTGTGAATTCCCAAGGGAGCTGG - Intronic
973882532 4:55288392-55288414 CTGTGGGATGCCAAGGCAGAAGG + Intergenic
973935017 4:55836673-55836695 TTGTGCTATTTCAAGGTAGAAGG - Intergenic
974382485 4:61159375-61159397 CTGTGTCATCCCATGGCAGACGG + Intergenic
974400840 4:61403773-61403795 CTGTGCTAACCCTAGGTAGGTGG + Intronic
976182094 4:82408452-82408474 CTTTGCGAGCCCAAGGCAGAAGG + Intergenic
976437341 4:85033285-85033307 CTGTGTCATCACATGGTAGAAGG + Intergenic
977612696 4:99052570-99052592 CTGTGCAGTACCAAGGGAGGTGG + Intronic
977706778 4:100080428-100080450 CTGTGCCATCCAATGGCAGAAGG + Intergenic
980773153 4:137404776-137404798 CTTTGGAATGCCAAGGTAGGAGG + Intergenic
982293578 4:153804323-153804345 CTGTGTCATCCCAAGGTGGAGGG + Intergenic
984753258 4:183299132-183299154 CTGTGTCATCCCATGGTGGAGGG + Intronic
987738076 5:21870458-21870480 CTGTGCTATCCTATGGTGGAAGG - Intronic
988080911 5:26414226-26414248 CTTTGGAAGGCCAAGGTAGATGG + Intergenic
988601009 5:32639465-32639487 CTGTGCAATCCCCAGGACGTAGG + Intergenic
991623761 5:68575552-68575574 CTTTGGAAGGCCAAGGTAGAGGG - Intergenic
992037154 5:72791171-72791193 CTGTGTTATCCCATGGTAGAGGG + Intergenic
993453863 5:88105088-88105110 CTGTGTATTCACATGGTAGAAGG - Intergenic
995380349 5:111524728-111524750 CTGTGCCCTCACATGGTAGAAGG - Intergenic
995494892 5:112731407-112731429 TTGTGTCATCCCAAGGTGGAAGG + Intronic
995506980 5:112870793-112870815 CTGTGTGATCCCATGGTGGAAGG - Intronic
996008458 5:118452258-118452280 CTGTGCCATCCCAAATTTGAAGG - Intergenic
996010529 5:118477562-118477584 CCTTGCAAGCCCAAGGTGGATGG + Intergenic
996215941 5:120865950-120865972 CATTGCAATTCCAAGGGAGATGG + Intergenic
997502506 5:134387620-134387642 CTGTGACATCCCATGGTGGAAGG + Intronic
997841176 5:137241672-137241694 CTGTGCCATCCCATGGCTGAAGG - Intronic
1001191275 5:169634049-169634071 CTGTGCCATCCCGTGGTGGAAGG - Intergenic
1001281626 5:170390260-170390282 CTTTGGGATGCCAAGGTAGATGG + Intronic
1001397497 5:171427817-171427839 CTATGCGATTCCAAGGCAGAAGG - Intronic
1001719778 5:173847494-173847516 CTGTGCGAGGCCAAGGTAGGAGG + Intergenic
1003210481 6:4059886-4059908 CTTTGGAAGCCCAAGGTAGGTGG - Intronic
1003238319 6:4318410-4318432 CTGTGCTAATCCCAGGTAGATGG + Intergenic
1003263109 6:4541155-4541177 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1003630771 6:7784832-7784854 CTGTGCAATCCCAAGGTAGAAGG - Intronic
1003848524 6:10198492-10198514 TTATGCAATCCCAAAGTACATGG + Intronic
1004072111 6:12309223-12309245 CTGTGTCCTCCCATGGTAGAAGG - Intergenic
1004078107 6:12363959-12363981 CTGTGCATAACCATGGTAGAAGG + Intergenic
1004383887 6:15155532-15155554 CTGTGTCATCCCACGGTGGAGGG - Intergenic
1010006974 6:71006257-71006279 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1010731508 6:79396211-79396233 AGGTGGAATCCCAAGGCAGAGGG - Intergenic
1011779075 6:90766449-90766471 CTCTGCAATTCCAAGGTGAATGG - Intergenic
1011889597 6:92140736-92140758 CTGTGTCTTCCCATGGTAGAAGG - Intergenic
1011943657 6:92873827-92873849 CTGTGTTATCCCATGGTGGAAGG - Intergenic
1012496144 6:99835577-99835599 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1014559185 6:122870405-122870427 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1014833318 6:126127920-126127942 CTGTAGAATCCCAGGATAGAGGG - Intergenic
1016563216 6:145420790-145420812 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1018644600 6:165935838-165935860 CTGTGTCATCCCATGGTGGAAGG - Intronic
1018805216 6:167254030-167254052 CTATGCAGTACCAAGGGAGATGG - Intergenic
1019446752 7:1075187-1075209 CTGAGCAATGACAAGCTAGACGG + Intronic
1019701492 7:2476656-2476678 CTGTGCAGGCGCAAGGGAGATGG + Intronic
1020676080 7:11186446-11186468 CTGTGTCCTCACAAGGTAGAAGG - Intergenic
1021149262 7:17129242-17129264 CTGAGAAATCCCAAGGTCAAGGG - Intergenic
1023875055 7:44282357-44282379 CTGTGCAGTCACAGGGCAGAAGG + Intronic
1024449521 7:49523149-49523171 ATGTACAATCCTAAGTTAGAGGG - Intergenic
1025111723 7:56222781-56222803 GAGTGCAATCCCAGGGTAGAAGG + Intergenic
1027269971 7:76513774-76513796 CTGTGCCGTCCCGAGGAAGAGGG + Intronic
1027878590 7:83802703-83802725 CTTTGGAATGCCAAGGTGGATGG + Intergenic
1029724083 7:102390762-102390784 TTGTGCAAGCCCAGGGTAGGTGG + Intronic
1029952582 7:104602825-104602847 CTGTGTCATCCCATGGCAGAAGG + Intronic
1030897497 7:115079028-115079050 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1031116612 7:117675900-117675922 CTGTGTCATCCCATGGCAGAAGG - Intronic
1031999869 7:128257882-128257904 CTGTGCCATCCCAAGGAATGAGG + Intergenic
1033366521 7:140676200-140676222 CTGTGTCATCACATGGTAGAAGG + Intronic
1036535194 8:9643337-9643359 CTGTGTCATCCCATGGTGGAAGG + Intronic
1036585972 8:10124030-10124052 CTCTGCAATCCCAAGGTCAAAGG - Intronic
1038283848 8:26189825-26189847 CTGAGCAGTCCCCAGGTAGCAGG - Intergenic
1038402081 8:27291793-27291815 CTGTGTCATCCCATGGCAGAAGG + Intronic
1038418520 8:27415991-27416013 CTTTGCAAAGCCAAGGTAGGAGG + Intronic
1038725296 8:30076781-30076803 CTGTGTCATCCCATGGTGGAAGG - Intronic
1039398110 8:37244663-37244685 CTGTGGAATCACATGGTAAAGGG + Intergenic
1042083317 8:65081065-65081087 CTGTAGAATCCCAAGTAAGATGG + Intergenic
1043357423 8:79429303-79429325 CTGTGTCATCACAAGGCAGAAGG - Intergenic
1044723780 8:95175751-95175773 CTGTGCAGGCCCACGGTGGAAGG + Intergenic
1048856331 8:138689470-138689492 CTCTGCAAGGCCAAGGCAGACGG + Intronic
1050206774 9:3204695-3204717 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1051251218 9:15160954-15160976 CTGTGTCATCCCAAAGTGGAAGG + Intergenic
1052127415 9:24794437-24794459 CTGTGTCATTCCAAGGCAGAAGG - Intergenic
1055297104 9:74844943-74844965 CTGTGGCATCTCAAGGTAGAGGG + Intronic
1055840109 9:80493519-80493541 CTGTGTCATCCCAGGGCAGAAGG + Intergenic
1056631090 9:88293705-88293727 CTGTGCTATCTCCAGGTAGATGG - Intergenic
1056889994 9:90483055-90483077 CTGTGCCCTCACATGGTAGAAGG + Intergenic
1057193820 9:93103759-93103781 CTGTGTTATCCCATGGTGGAAGG + Intronic
1057362327 9:94384975-94384997 CTGCGTTATCCCAAGGGAGAAGG - Intronic
1057661014 9:97003125-97003147 CTGCGTTATCCCAAGGGAGAAGG + Intronic
1057867181 9:98690892-98690914 CTGTGCAGTCACAGGGCAGAAGG - Intronic
1058543383 9:106035433-106035455 TTGTGAACTGCCAAGGTAGAGGG - Intergenic
1061642234 9:131968227-131968249 CTCTGGAATGCCAAGGTAGGAGG + Intronic
1062005294 9:134235733-134235755 CTGTGCAATGCCAACAGAGACGG + Intergenic
1062589837 9:137268677-137268699 CTGTGTCATCCCATGGTGGAAGG + Intronic
1185805311 X:3051517-3051539 CTTTGCATTCCCCAGGTAGCAGG - Intronic
1185828589 X:3276630-3276652 CTGTGCCCTCACATGGTAGAAGG - Intronic
1186236828 X:7521102-7521124 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1186564685 X:10650300-10650322 CTGTCCAATCCTTATGTAGATGG - Intronic
1186625814 X:11292351-11292373 ATGTGTTATACCAAGGTAGAGGG + Intronic
1186989499 X:15052156-15052178 CTGTGTCATCCCATGGTAGAAGG + Intergenic
1187280667 X:17856423-17856445 CTGTGCCCTCACATGGTAGAAGG - Intronic
1187550002 X:20293052-20293074 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1187944647 X:24414446-24414468 CTGTGTCATCCCACGGCAGAAGG - Intergenic
1188043850 X:25402896-25402918 CTGTTCAAGCCCAAGGTGTAGGG + Intergenic
1188128259 X:26398327-26398349 CTGTGCCATCCCATGGCAGAAGG - Intergenic
1188520075 X:31029146-31029168 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1188814199 X:34691129-34691151 CTATGGAAGGCCAAGGTAGAAGG + Intergenic
1189390681 X:40573953-40573975 CTGTGCTATCCCATGGCAGAAGG - Intergenic
1189582131 X:42417768-42417790 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1189791722 X:44611360-44611382 CTGTGGAAGGCCAAGGTAGGAGG + Intergenic
1194057917 X:89160868-89160890 CTCTGGAAGGCCAAGGTAGATGG - Intergenic
1194619637 X:96154221-96154243 TTGTGCAATCACAAGGTCAAAGG + Intergenic
1194633248 X:96312391-96312413 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1194979097 X:100422489-100422511 CTGTGTATTCACATGGTAGAAGG - Intergenic
1195292588 X:103443470-103443492 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1195309771 X:103620791-103620813 CTGTGTACTCACATGGTAGAAGG + Intronic
1200382979 X:155859130-155859152 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1201275954 Y:12299085-12299107 CTTTGCATTCCCCAGGTAGCAGG + Intergenic
1201289793 Y:12412177-12412199 CTGTGTAATTGCAAAGTAGATGG + Intergenic